Vibrio cholerae 1587 , whole genome shotgun [asmbl_id: NC_000000].4137501, GC%: 47.45%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(149709..151133) PHAGE_Burkho_BcepC6B: putative TerL; A55_1888; phage(gi48697193) 5e-64 Click
2complement(151279..152121) PHAGE_Escher_TL_2011c: putative terminase small subunit; A55_1889; phage(gi418487072) 4e-21 Click
3complement(152288..152476) hypothetical protein; A55_1890 0.0 Click
4complement(152627..153073) PHAGE_Entero_ES18: gp77; A55_1891; phage(gi62362290) 2e-16 Click
5complement(153057..153611) PHAGE_Entero_cdtI: lysin; A55_1892; phage(gi148609440) 2e-20 Click
6complement(153608..153889) hypothetical protein; A55_1893 0.0 Click
7complement(154071..154262) hypothetical protein; A55_1894 0.0 Click
8complement(154549..155316) conserved hypothetical protein; A55_1895 0.0 Click
9complement(155313..155714) PHAGE_Psychr_pOW20_A: hypothetical protein; A55_1896; phage(gi472339811) 2e-17 Click
10complement(155756..156043) PHAGE_Entero_HK542: hypothetical protein; A55_1897; phage(gi428783392) 5e-13 Click
11complement(156043..156624) PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; A55_1898; phage(gi169257286) 7e-35 Click
12complement(156636..156830) hypothetical protein; A55_1899 0.0 Click
13complement(156836..157075) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; A55_1900; phage(gi414087047) 2e-13 Click
14complement(157138..157821) PHAGE_Salmon_c341: DNA Repair ATPase; A55_1901; phage(gi255252706) 2e-23 Click
15complement(157818..158165) conserved hypothetical protein; A55_1902 0.0 Click
16complement(158162..158530) hypothetical protein; A55_1903 0.0 Click
17complement(158527..159204) PHAGE_Pseudo_PAJU2: putative replication protein P; A55_1904; phage(gi209552483) 6e-18 Click
18complement(159209..160087) PHAGE_Entero_mEp390: hypothetical protein; A55_1905; phage(gi428782706) 8e-24 Click
19complement(160090..160332) conserved hypothetical protein; A55_1906 0.0 Click
20complement(160422..160622) hypothetical protein; A55_1907 0.0 Click
21complement(160636..160956) hypothetical protein; A55_1908 0.0 Click
22complement(160990..161244) PHAGE_Entero_phiP27: hypothetical protein P27p12; A55_1909; phage(gi18249876) 4e-05 Click
23161373..162050 PHAGE_Entero_cdtI: Repressor; A55_1910; phage(gi148609423) 7e-27 Click
24162590..163021 PHAGE_Pseudo_AF: putative tellurite resistance protein; A55_1911; phage(gi431810338) 9e-29 Click

Region 2, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1165778..165795 attL    TGAGGTAACGACCAATGA 0.0 Click
2166633..168333 PHAGE_Erwini_vB_EamM_Y2: tail fiber; A55_1917; phage(gi422934766) 4e-14 Click
3168409..168693 PHAGE_Entero_SPC35: hypothetical protein; A55_1918; phage(gi326632977) 1e-19 Click
4168750..168893 hypothetical protein; A55_1919 0.0 Click
5168883..169137 hypothetical protein; A55_1920 0.0 Click
6169134..169382 hypothetical protein; A55_1921 0.0 Click
7169403..170311 PHAGE_Entero_P1: HrdC; A55_1923; phage(gi46401690) 3e-62 Click
8complement(170308..170427) hypothetical protein; A55_1922 0.0 Click
9171024..172550 PHAGE_Salmon_SPN1S: putative bacteriophage protein; A55_1924; phage(gi374531224) 8e-32 Click
10172576..173163 conserved hypothetical protein; A55_1925 0.0 Click
11173156..173365 hypothetical protein; A55_1926 0.0 Click
12173349..173843 hypothetical protein; A55_1927 0.0 Click
13173840..174496 PHAGE_Salmon_ST64B: putative DNA methyltransferase; A55_1928; phage(gi23505488) 4e-49 Click
14174493..175194 PHAGE_Salmon_SPN1S: hypothetical protein; A55_1929; phage(gi374531240) 2e-18 Click
15175191..175367 hypothetical protein; A55_1930 0.0 Click
16175378..175602 hypothetical protein; A55_1931 0.0 Click
17complement(175714..175875) hypothetical protein; A55_1932 0.0 Click
18complement(175914..176048) hypothetical protein; A55_1933 0.0 Click
19176135..176317 hypothetical protein; A55_1934 0.0 Click
20176486..176791 hypothetical protein; A55_1935 0.0 Click
21176893..177015 conserved hypothetical protein; A55_1936 0.0 Click
22177017..177256 conserved hypothetical protein; A55_1937 0.0 Click
23177253..177438 PHAGE_Vibrio_CP_T1: hypothetical protein; A55_1938; phage(gi418489213) 1e-24 Click
24177860..177877 attR    TGAGGTAACGACCAATGA 0.0 Click
25177874..178122 PHAGE_Escher_TL_2011c: putative excisionase; A55_1939; phage(gi418487052) 1e-05 Click
26178133..179371 PROPHAGE_Escher_Sakai: putative integrase; A55_1940; phage(gi15832267) 2e-100 Click
27179376..181739 PHAGE_Mycoba_Rizal: gp133; A55_1941; phage(gi203457480) 3e-05 Click

Region 3, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(425236..426354) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; A55_1295; phage(gi399529005) 4e-05 Click
2complement(426601..426676) tRNA 0.0 Click
3complement(426687..426773) tRNA 0.0 Click
4complement(426838..426913) tRNA 0.0 Click
5complement(426916..427639) PHAGE_Singap_iridovirus: hypothetical protein ORF141R; A55_A0723; phage(gi56692778) 9e-15 Click
6complement(427639..428268) PHAGE_Escher_TL_2011c: hypothetical protein; A55_A0724; phage(gi418487106) 8e-24 Click
7complement(428268..428867) PHAGE_Escher_TL_2011c: hypothetical protein; A55_A0725; phage(gi418487105) 1e-07 Click
8complement(428870..429334) PHAGE_Escher_TL_2011c: hypothetical protein; A55_A0726; phage(gi418487104) 7e-33 Click
9complement(429392..429772) PHAGE_Escher_TL_2011c: hypothetical protein; A55_A0727; phage(gi418487103) 3e-15 Click
10complement(429787..430992) PHAGE_Escher_TL_2011c: hypothetical protein; A55_A0728; phage(gi418487102) 4e-136 Click
11complement(431055..432059) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp15; A55_A0729; phage(gi116222007) 3e-35 Click
12complement(432177..432437) hypothetical protein; A55_A0730 0.0 Click
13complement(432449..433027) hypothetical protein; A55_A0731 0.0 Click
14complement(433030..433251) hypothetical protein; A55_A0732 0.0 Click
15complement(433264..433392) conserved hypothetical protein; A55_0972 0.0 Click
16complement(433346..433489) conserved hypothetical protein; A55_A0733 0.0 Click
17complement(433527..433685) conserved hypothetical protein; A55_A0734 0.0 Click
18complement(433695..434213) PHAGE_Vibrio_CP_T1: hypothetical protein; A55_A0735; phage(gi418489254) 7e-56 Click
19complement(434282..434593) PHAGE_Cronob_ENT47670: phage holin; A55_A0736; phage(gi431810538) 4e-12 Click

Region 4, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(439573..440829) PHAGE_Cronob_ENT39118: DNA polymerase; A55_A0738; phage(gi431811050) 3e-83 Click
2complement(440829..441236) PHAGE_Cronob_ENT39118: protein umuD; A55_A0739; phage(gi431811072) 8e-20 Click
3441182..441196 attL    CAGCACTTTCAAAAC 0.0 Click
4complement(441397..443484) PHAGE_Escher_TL_2011c: putative portal protein; A55_A0740; phage(gi418487074) 0.0 Click
5complement(443481..445178) PHAGE_Entero_Min27: putative large subunit terminase; A55_A0741; phage(gi170783661) 0.0 Click
6complement(445171..446016) PHAGE_Escher_TL_2011c: putative terminase small subunit; A55_A0742; phage(gi418487072) 1e-18 Click
7complement(446130..446948) conserved hypothetical protein; A55_A0743 0.0 Click
8complement(447012..447914) PHAGE_Entero_phiP27: hypothetical protein P27p17; A55_A0744; phage(gi18249881) 8e-09 Click
9complement(448146..448310) hypothetical protein; A55_A0745 0.0 Click
10complement(448611..448847) PHAGE_Entero_ST64T: Cro; A55_A0746; phage(gi24371558) 2e-11 Click
11448972..449631 PHAGE_Entero_ST64T: C2; A55_A0747; phage(gi24371557) 3e-68 Click
12449850..450113 hypothetical protein; A55_A0748 0.0 Click
13450119..450301 transcriptional regulator, putative; A55_A0749 0.0 Click
14450283..451506 PROPHAGE_Escher_Sakai: putative integrase; A55_A0750; phage(gi15832267) 3e-61 Click
15465049..465063 attR    CAGCACTTTCAAAAC 0.0 Click

Region 5, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11400881..1400904 attL    GAAAAGGGGCTTTTCTTTTTTCTG 0.0 Click
2complement(1401114..1402151) PHAGE_Vibrio_K139: Int; A55_2436; phage(gi17975106) 0.0 Click
3complement(1402154..1402954) hypothetical protein; A55_2435 0.0 Click
41403775..1403987 PHAGE_Vibrio_K139: Cox; A55_2434; phage(gi17975110) 3e-34 Click
51404098..1404637 PHAGE_Vibrio_K139: CII; A55_2433; phage(gi17975111) 2e-95 Click
61404650..1405084 PHAGE_Vibrio_K139: hypothetical protein K139p07; A55_2432; phage(gi17975112) 2e-77 Click
71405166..1405732 PHAGE_Vibrio_K139: hypothetical protein K139p08; A55_2431; phage(gi17975113) 9e-34 Click
81405729..1406139 PHAGE_Vibrio_K139: hypothetical protein K139p09; A55_2430; phage(gi17975114) 1e-29 Click
91406139..1406366 PHAGE_Vibrio_K139: hypothetical protein K139p11; A55_2429; phage(gi17975116) 1e-24 Click
101406363..1406476 conserved hypothetical protein; A55_2428 0.0 Click
111406473..1406802 PHAGE_Escher_D108: hypothetical protein; A55_2427; phage(gi281199653) 2e-07 Click
121406851..1407996 PHAGE_Stenot_S1: putative PAPS; A55_2426; phage(gi213163929) 2e-53 Click
131408005..1410566 PHAGE_Vibrio_K139: rep; A55_2425; phage(gi17975119) 0.0 Click
141410735..1411112 PHAGE_Vibrio_K139: hypothetical protein K139p15; A55_2424; phage(gi17975120) 1e-69 Click
15complement(1411186..1411524) PHAGE_Vibrio_K139: hypothetical protein K139p16; A55_2423; phage(gi17975121) 1e-56 Click
16complement(1412008..1412136) PHAGE_Vibrio_K139: zinc-finger protein; A55_2422; phage(gi17975123) 7e-18 Click
17complement(1412330..1412545) PHAGE_Vibrio_K139: hypothetical protein K139p19; A55_2421; phage(gi17975124) 2e-35 Click
18complement(1412529..1413575) PHAGE_Vibrio_K139: putative capsid portal protein; A55_2420; phage(gi17975125) 0.0 Click
19complement(1413572..1415392) PHAGE_Vibrio_K139: putative terminase, ATPase subunit; A55_2419; phage(gi17975126) 0.0 Click
201415564..1416448 PHAGE_Vibrio_K139: putative capsid scaffolding protein; A55_2418; phage(gi17975127) 3e-113 Click
211416485..1417495 PHAGE_Vibrio_K139: putative major capsid protein; A55_2417; phage(gi17975128) 3e-162 Click
221417511..1418227 PHAGE_Vibrio_K139: putative terminase, endonuclease subunit; A55_2416; phage(gi17975129) 1e-127 Click
231418334..1418795 PHAGE_Vibrio_K139: putative head completion protein; A55_2415; phage(gi17975130) 1e-80 Click
241418822..1419274 PHAGE_Vibrio_K139: hypothetical protein K139p26; A55_2414; phage(gi17975131) 2e-51 Click
251419511..1419927 PHAGE_Aeromo_phiO18P: putative tail completion protein; A55_2413; phage(gi148727157) 3e-08 Click
261419929..1421038 PHAGE_Vibrio_K139: putative tail sheath protein; A55_2412; phage(gi17975134) 0.0 Click
271421038..1421496 PHAGE_Vibrio_K139: putative tail tube protein; A55_2411; phage(gi17975135) 7e-83 Click
281421511..1421720 PHAGE_Vibrio_K139: C4-type zinc-finger; A55_2410; phage(gi17975136) 7e-32 Click
291421717..1421929 PHAGE_Vibrio_K139: hypothetical protein K139p32; A55_2409; phage(gi17975137) 4e-32 Click
301421916..1422503 PHAGE_Vibrio_K139: putative endolysin; A55_2408; phage(gi17975138) 2e-112 Click
311422478..1422819 PHAGE_Vibrio_K139: hypothetical protein K139p34; A55_2407; phage(gi17975139) 4e-54 Click
321422869..1423030 PHAGE_Vibrio_K139: hypothetical protein K139p35; A55_2406; phage(gi17975140) 6e-21 Click
331423027..1423308 PHAGE_Vibrio_K139: hypothetical protein K139p35; A55_2405; phage(gi17975140) 4e-47 Click
341423359..1423493 PHAGE_Pasteu_F108: hypothetical protein F108p32; A55_2404; phage(gi109302928) 8e-07 Click
351423505..1425322 PHAGE_Vibrio_K139: putative tail length determinator; A55_2403; phage(gi17975141) 0.0 Click
361425312..1425644 PHAGE_Vibrio_K139: hypothetical protein K139p37; A55_2402; phage(gi17975142) 2e-57 Click
371425641..1426840 PHAGE_Vibrio_K139: hypothetical protein K139p38; A55_2401; phage(gi17975143) 0.0 Click
381426837..1427496 PHAGE_Vibrio_K139: hypothetical protein K139p39; A55_2400; phage(gi17975144) 7e-127 Click
391427493..1429334 PHAGE_Vibrio_K139: putative tail fiber protein; A55_2399; phage(gi17975145) 0.0 Click
401429334..1429867 PHAGE_Vibrio_K139: putative tail fiber assembly protein; A55_2398; phage(gi17975146) 2e-84 Click
411429870..1430763 PHAGE_Vibrio_K139: hypothetical protein K139p42; A55_2397; phage(gi17975147) 8e-158 Click
421430751..1431224 PHAGE_Vibrio_K139: hypothetical protein K139p43; A55_2396; phage(gi17975148) 5e-83 Click
431431221..1432852 PHAGE_Vibrio_K139: hypothetical protein K139p44; A55_2395; phage(gi17975149) 0.0 Click
441433526..1433549 attR    GAAAAGGGGCTTTTCTTTTTTCTG 0.0 Click

Region 6, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12078203..2078451 PHAGE_Vibrio_fs1: hypothetical protein fs1p10; A55_1584; phage(gi23455832) 3e-41 Click
22078462..2078665 PHAGE_Vibrio_VEJphi: hypothetical protein; A55_1585; phage(gi238821383) 3e-37 Click
32078655..2079758 PHAGE_Vibrio_VEJphi: rolling circle replication protein; A55_1586; phage(gi238821373) 7e-156 Click
42079763..2080101 PHAGE_Vibrio_VEJphi: single-stranded DNA binding protein; A55_1587; phage(gi238821374) 8e-60 Click
52080111..2080356 PHAGE_Vibrio_VEJphi: putative minor capsid protein; A55_1588; phage(gi238821375) 1e-42 Click
62080368..2080502 PHAGE_Vibrio_VEJphi: major capsid protein; A55_1589; phage(gi238821376) 6e-17 Click
72080644..2081927 PHAGE_Vibrio_VEJphi: minor capsid protein; A55_1590; phage(gi238821378) 4e-176 Click
82081940..2082482 PROPHAGE_Escher_Sakai: intramembrane serine protease GlpG; A55_0117; phage(gi15833521) 1e-40 Click
92082858..2084837 PHAGE_Lactob_LF1: tail fiber; A55_0116; phage(gi418489400) 7e-06 Click

Region 7, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13725501..3726082 PHAGE_Vibrio_1phi: putative replication protein; A55_1591; phage(gi52221122) 9e-102 Click
23726082..3726207 PHAGE_Vibrio_1phi: putative ssDNA binding protein; A55_1592; phage(gi52221123) 1e-12 Click
33726273..3726422 PHAGE_Vibrio_fs1: hypothetical protein fs1p14; A55_1593; phage(gi23455836) 1e-20 Click
43726696..3726905 PHAGE_Vibrio_VCY_phi: hypothetical protein; A55_1594; phage(gi358356475) 3e-16 Click
53727038..3728432 PHAGE_Vibrio_1phi: hypothetical protein KSF-1phigpORFV; A55_1595; phage(gi52221126) 5e-165 Click
63728432..3728776 PHAGE_Vibrio_1phi: hypothetical protein KSF-1phigpORFVIII; A55_1596; phage(gi52221129) 5e-58 Click
73728779..3730149 PHAGE_Vibrio_1phi: Zot-like protein; A55_1597; phage(gi52221130) 0.0 Click
83730160..3730345 PHAGE_Vibrio_1phi: hypothetical protein KSF-1phigpORFX; A55_1598; phage(gi52221131) 3e-15 Click