Staphylococcus aureus subsp. aureus USA300_TCH959 , [asmbl_id: NC_000000].2810505, GC%: 32.94%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
141047..42405 PHAGE_Bacill_B4: cell division FtsK/SpoIIIE-like protein; HMPREF0776_0046; phage(gi410493290) 9e-13 Click
242410..44257 PHAGE_Human__8: LANA; HMPREF0776_0047; phage(gi139472804) 7e-08 Click
344247..45293 PHAGE_Staphy_JD007: tail lysin; HMPREF0776_0048; phage(gi428783012) 5e-20 Click
445300..45890 conserved hypothetical protein; HMPREF0776_0049 0.0 Click
545946..46287 conserved hypothetical protein; HMPREF0776_0050 0.0 Click
646396..46899 PHAGE_Staphy_phiPV83: transposase; HMPREF0776_0051; phage(gi9635740) 2e-07 Click
747063..47416 PHAGE_Spirop_R8A2B: putative transposase; HMPREF0776_0052; phage(gi9626114) 2e-13 Click
8complement(47621..47890) conserved hypothetical protein; HMPREF0776_0053 0.0 Click
9complement(48060..49421) PHAGE_Acanth_mimivirus: putative RNA methyltransferase; HMPREF0776_0054; phage(gi311977789) 4e-37 Click

Region 2, total : 71 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
193355..93366 attL    AAGTTGCAACAC 0.0 Click
293890..94069 PHAGE_Staphy_phiN315: hypothetical protein SAS058; HMPREF0776_0103; phage(gi30043926) 6e-28 Click
394093..94401 PHAGE_Staphy_phiN315: hypothetical protein SA1753; HMPREF0776_0104; phage(gi30043927) 3e-49 Click
494449..94640 conserved hypothetical protein; HMPREF0776_0105 0.0 Click
5complement(94693..95043) PHAGE_Staphy_phiNM3: Staphylococcal complement inhibitor; HMPREF0776_0106; phage(gi118725117) 7e-59 Click
6complement(95554..95850) PHAGE_Staphy_phiNM3: truncated amidase; HMPREF0776_0107; phage(gi118725115) 1e-51 Click
7complement(96540..97031) PHAGE_Staphy_phiNM3: staphylokinase precursor; HMPREF0776_0108; phage(gi118725114) 1e-89 Click
8complement(97222..97977) PHAGE_Staphy_phiNM3: amidase; HMPREF0776_0109; phage(gi118725113) 7e-154 Click
9complement(97989..98282) PHAGE_Staphy_phiNM3: holin; HMPREF0776_0110; phage(gi118725112) 3e-43 Click
10complement(98455..98589) PHAGE_Staphy_phiN315: hypothetical protein SAS059; HMPREF0776_0111; phage(gi30043935) 2e-16 Click
11complement(98834..99616) PHAGE_Staphy_phiNM3: enterotoxin type A precursor; HMPREF0776_0112; phage(gi118725111) 2e-111 Click
12complement(100028..100402) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0113; phage(gi118725110) 6e-65 Click
13complement(100458..100745) PHAGE_Staphy_phiN315: hypothetical protein SA1763; HMPREF0776_0114; phage(gi30043939) 1e-44 Click
14complement(100792..100944) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0115; phage(gi118725108) 7e-23 Click
15complement(100934..102190) PHAGE_Staphy_phiNM3: phage minor structural protein; HMPREF0776_0116; phage(gi118725107) 0.0 Click
16complement(102236..104719) PHAGE_Staphy_phiNM3: phage minor structural protein; HMPREF0776_0117; phage(gi118725107) 0.0 Click
17complement(104735..105877) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0118; phage(gi118725106) 0.0 Click
18complement(105878..106219) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0119; phage(gi118725106) 3e-64 Click
19complement(106216..109449) PHAGE_Staphy_phiNM3: phage tail tape measure protein; HMPREF0776_0120; phage(gi118725105) 0.0 Click
20complement(109450..110760) PHAGE_Staphy_phiNM3: phage tail tape measure protein; HMPREF0776_0121; phage(gi118725105) 0.0 Click
21complement(110817..110978) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0122; phage(gi118725104) 3e-19 Click
22complement(111005..111355) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0123; phage(gi118725103) 1e-61 Click
23complement(111405..111545) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0124; phage(gi118725102) 4e-19 Click
24complement(111671..112315) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0125; phage(gi118725101) 2e-122 Click
25complement(112316..112723) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0126; phage(gi118725100) 8e-76 Click
26complement(112720..113124) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0127; phage(gi118725099) 7e-72 Click
27complement(113121..113483) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0128; phage(gi118725098) 2e-67 Click
28complement(113467..113763) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0129; phage(gi118725097) 2e-48 Click
29complement(113741..114025) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0130; phage(gi118725096) 4e-49 Click
30complement(114045..115190) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0131; phage(gi118725095) 0.0 Click
31complement(115214..115957) PHAGE_Staphy_phiNM3: putative Clp protease; HMPREF0776_0132; phage(gi118725094) 8e-134 Click
32complement(115935..117122) PHAGE_Staphy_phiNM3: phage portal protein; HMPREF0776_0133; phage(gi118725093) 0.0 Click
33complement(117138..118799) PHAGE_Staphy_phiNM3: phage terminase; HMPREF0776_0134; phage(gi118725092) 0.0 Click
34complement(118796..119140) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0135; phage(gi118725091) 3e-60 Click
35complement(119270..119569) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0136; phage(gi118725090) 6e-57 Click
36complement(119801..120217) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0137; phage(gi118725089) 6e-79 Click
37complement(120245..120445) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0138; phage(gi118725088) 5e-32 Click
38complement(120445..120594) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0139; phage(gi118725087) 3e-21 Click
39complement(120591..120977) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0140; phage(gi118725086) 2e-67 Click
40complement(120974..121180) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0141; phage(gi118725085) 3e-33 Click
41complement(121177..121422) PHAGE_Staphy_52A: ORF063; HMPREF0776_0142; phage(gi66396316) 3e-40 Click
42complement(121459..121995) PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp31; HMPREF0776_0143; phage(gi118430755) 3e-98 Click
43complement(121988..122245) PHAGE_Staphy_phi5967PVL: phi PVL ORF 52 family protein; HMPREF0776_0144; phage(gi431810263) 5e-42 Click
44complement(122251..122493) PHAGE_Staphy_69: ORF062; HMPREF0776_0145; phage(gi66395343) 7e-42 Click
45complement(122497..122874) PHAGE_Staphy_TEM123: PVL phage protein; HMPREF0776_0146; phage(gi388570356) 6e-65 Click
46complement(122878..123294) PHAGE_Staphy_phiNM3: putative endodeoxyribonuclease RusA; HMPREF0776_0147; phage(gi118725078) 2e-75 Click
47complement(123291..123509) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0148; phage(gi118725077) 2e-39 Click
48complement(123516..124409) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0149; phage(gi118725076) 2e-105 Click
49complement(124439..124909) PHAGE_Staphy_phiNM3: putative single-strand DNA-binding protein; HMPREF0776_0150; phage(gi118725075) 3e-85 Click
50complement(124910..125395) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0151; phage(gi118725074) 1e-88 Click
51complement(125608..126528) PHAGE_Staphy_phiNM3: RecT protein; HMPREF0776_0152; phage(gi118725073) 5e-175 Click
52complement(126530..128485) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0153; phage(gi118725072) 0.0 Click
53complement(128482..128760) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0154; phage(gi118725071) 8e-49 Click
54complement(128754..129014) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0155; phage(gi118725070) 5e-43 Click
55complement(129019..129321) PHAGE_Staphy_phiN315: hypothetical protein SA1798; HMPREF0776_0156; phage(gi30043976) 3e-51 Click
56complement(129416..129577) PHAGE_Staphy_phiN315: hypothetical protein SAS063; HMPREF0776_0157; phage(gi30043977) 6e-25 Click
57complement(129574..129897) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0158; phage(gi118725066) 3e-54 Click
58129952..130332 PHAGE_Staphy_phiN315: hypothetical protein SA1800; HMPREF0776_0159; phage(gi30043979) 2e-71 Click
59complement(130319..130516) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0160; phage(gi118725064) 6e-33 Click
60complement(130532..131284) PHAGE_Staphy_phiNM3: antirepressor; HMPREF0776_0161; phage(gi118725063) 8e-142 Click
61131335..131664 PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0162; phage(gi118725062) 3e-56 Click
62complement(131653..131868) PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0163; phage(gi118725061) 1e-35 Click
63complement(131884..132147) PHAGE_Staphy_phiNM3: transcriptional regulator; HMPREF0776_0164; phage(gi118725060) 6e-44 Click
64132280..132993 PHAGE_Staphy_phiNM3: putative repressor; HMPREF0776_0165; phage(gi118725059) 9e-134 Click
65133009..133941 PHAGE_Staphy_phiNM3: probable ATP-dependent helicase; HMPREF0776_0166; phage(gi118725058) 2e-176 Click
66133947..134288 PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0167; phage(gi118725057) 2e-59 Click
67134492..134674 PHAGE_Staphy_phiNM3: hypothetical protein; HMPREF0776_0168; phage(gi118725056) 5e-29 Click
68134774..135238 PHAGE_Staphy_phiNM3: putative lipoprotein; HMPREF0776_0169; phage(gi118725055) 3e-83 Click
69134931..134942 attR    AAGTTGCAACAC 0.0 Click
70135297..136334 PHAGE_Staphy_phiNM3: integrase; HMPREF0776_0170; phage(gi118725054) 0.0 Click
71136391..137215 sphingomyelin phosphodiesterase; HMPREF0776_0171 0.0 Click
72complement(137626..138642) PHAGE_Staphy_phiPV83: LukF-PV(P83) precursor; HMPREF0776_0172; phage(gi9635737) 2e-59 Click
73complement(138664..139716) PHAGE_Staphy_phiPV83: LukM precursor; HMPREF0776_0173; phage(gi9635736) 4e-44 Click

Region 3, total : 67 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11739671..1739724 attL    TCGAAATGGAAGGTAGTATTGGATAGCTTTAAACCGCGTTGTTAAGCCATTCTT 0.0 Click
2complement(1739764..1740813) PHAGE_Staphy_phiETA3: integrase; HMPREF0776_1838; phage(gi122891785) 0.0 Click
3complement(1741010..1741714) PHAGE_Staphy_phiMR25: hypothetical protein; HMPREF0776_1839; phage(gi189427124) 6e-43 Click
4complement(1741746..1742477) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp04; HMPREF0776_1840; phage(gi122891788) 3e-132 Click
5complement(1742499..1743173) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp05; HMPREF0776_1841; phage(gi122891789) 4e-129 Click
6complement(1743190..1743522) PHAGE_Staphy_phiETA3: repressor; HMPREF0776_1842; phage(gi122891790) 2e-59 Click
71743665..1743979 PHAGE_Staphy_phiETA3: Cro protein; HMPREF0776_1843; phage(gi122891791) 3e-28 Click
81743979..1744743 PHAGE_Staphy_phiETA3: anti-repressor protein; HMPREF0776_1844; phage(gi122891792) 6e-142 Click
91744760..1744954 PHAGE_Staphy_69: ORF077; HMPREF0776_1845; phage(gi66395352) 3e-28 Click
101744985..1745128 PHAGE_Staphy_EW: ORF133; HMPREF0776_1846; phage(gi66395875) 2e-17 Click
11complement(1745149..1745706) hypothetical protein; HMPREF0776_1847 0.0 Click
121745780..1745998 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp11; HMPREF0776_1848; phage(gi122891795) 1e-33 Click
131745991..1746152 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp12; HMPREF0776_1849; phage(gi122891796) 3e-24 Click
141746244..1746504 PHAGE_Staphy_X2: ORF062; HMPREF0776_1850; phage(gi66394721) 5e-46 Click
151746514..1746735 PHAGE_Staphy_3: hypothetical protein SPTP3103_gp14; HMPREF0776_1851; phage(gi156604031) 1e-37 Click
161746728..1747351 PHAGE_Staphy_phiMR25: hypothetical protein; HMPREF0776_1852; phage(gi189427137) 4e-118 Click
171747351..1747779 PHAGE_Staphy_phiMR25: putative single stranded DNA binding protein; HMPREF0776_1853; phage(gi189427138) 6e-78 Click
181747793..1748467 PHAGE_Staphy_42E: ORF019; HMPREF0776_1854; phage(gi66395527) 3e-127 Click
191748464..1748613 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp19; HMPREF0776_1855; phage(gi122891803) 9e-21 Click
20complement(1748606..1748887) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp20; HMPREF0776_1856; phage(gi122891804) 2e-51 Click
211748863..1749723 PHAGE_Staphy_phiETA3: Rep protein; HMPREF0776_1857; phage(gi122891805) 4e-170 Click
221749733..1750512 PHAGE_Staphy_phiETA3: replicative DNA helicase; HMPREF0776_1858; phage(gi122891806) 1e-151 Click
231750506..1750664 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp23; HMPREF0776_1859; phage(gi122891807) 7e-24 Click
241750677..1750898 PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp25; HMPREF0776_1860; phage(gi122891739) 2e-37 Click
251750888..1751313 PHAGE_Staphy_phiMR25: hypothetical protein; HMPREF0776_1861; phage(gi189427145) 9e-76 Click
261751318..1751503 PHAGE_Staphy_71: ORF090; HMPREF0776_1862; phage(gi66396103) 4e-29 Click
271751504..1751860 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp28; HMPREF0776_1863; phage(gi122891812) 1e-61 Click
281751864..1752106 PHAGE_Staphy_phiSLT: phi PVL ORF 51 analogue; HMPREF0776_1864; phage(gi12719418) 8e-44 Click
291752112..1752369 PHAGE_Staphy_phiSLT: phi PVL ORF 52 analogue; HMPREF0776_1865; phage(gi12719419) 2e-40 Click
301752362..1752898 PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p30; HMPREF0776_1866; phage(gi9635706) 1e-97 Click
311752935..1753141 PHAGE_Staphy_2: hypothetical protein SPTP3102_gp33; HMPREF0776_1867; phage(gi156603982) 2e-32 Click
321753138..1753341 PHAGE_Staphy_2: hypothetical protein SPTP3102_gp34; HMPREF0776_1868; phage(gi156603983) 4e-33 Click
331753334..1753570 PHAGE_Staphy_2: hypothetical protein SPTP3102_gp35; HMPREF0776_1869; phage(gi156603984) 1e-40 Click
341753560..1753949 PHAGE_Staphy_phiMR11: hypothetical protein; HMPREF0776_1870; phage(gi162290144) 2e-69 Click
351753946..1754119 PHAGE_Staphy_phiETA3: transcriptional activator RinB; HMPREF0776_1871; phage(gi122891821) 2e-25 Click
361754120..1754521 PHAGE_Staphy_phiMR11: hypothetical protein; HMPREF0776_1872; phage(gi162290146) 9e-72 Click
371754876..1755370 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp40; HMPREF0776_1873; phage(gi122891824) 1e-88 Click
381755363..1756586 PHAGE_Staphy_phiETA3: large terminase; HMPREF0776_1874; phage(gi122891825) 0.0 Click
391756583..1758007 PHAGE_Staphy_phiETA3: portal protein; HMPREF0776_1875; phage(gi122891826) 0.0 Click
401757976..1758926 PHAGE_Staphy_phiETA3: minor head protein; HMPREF0776_1876; phage(gi122891827) 5e-176 Click
411759022..1759606 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp45; HMPREF0776_1877; phage(gi122891829) 1e-105 Click
421759623..1760537 PHAGE_Staphy_phiETA3: major capsid protein; HMPREF0776_1878; phage(gi122891830) 1e-172 Click
431760549..1760692 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp47; HMPREF0776_1879; phage(gi122891831) 2e-20 Click
441760689..1761048 PHAGE_Staphy_phiETA3: head completion protein; HMPREF0776_1880; phage(gi122891832) 4e-63 Click
451761060..1761395 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp49; HMPREF0776_1881; phage(gi122891833) 5e-60 Click
461761382..1761789 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp50; HMPREF0776_1882; phage(gi122891834) 9e-62 Click
471761802..1762227 PHAGE_Staphy_phiETA3: tail protein; HMPREF0776_1883; phage(gi122891835) 1e-74 Click
481762228..1762785 PHAGE_Staphy_phiETA3: major tail protein; HMPREF0776_1884; phage(gi122891836) 3e-105 Click
491762852..1763358 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp53; HMPREF0776_1885; phage(gi122891837) 1e-94 Click
501763403..1763687 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp54; HMPREF0776_1886; phage(gi122891838) 2e-21 Click
511763706..1766576 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp55; HMPREF0776_1887; phage(gi122891839) 0.0 Click
521766591..1767532 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp56; HMPREF0776_1888; phage(gi122891840) 0.0 Click
531767543..1769429 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp57; HMPREF0776_1889; phage(gi122891841) 0.0 Click
541769475..1771340 PHAGE_Staphy_ROSA: ORF002; HMPREF0776_1890; phage(gi66395967) 0.0 Click
551771340..1773163 PHAGE_Staphy_85: ORF005; HMPREF0776_1891; phage(gi66394875) 0.0 Click
561773163..1773540 PHAGE_Staphy_85: ORF040; HMPREF0776_1892; phage(gi66394905) 3e-66 Click
571773541..1773723 PHAGE_Staphy_80alpha: hypothetical protein SPV-80A_gp65; HMPREF0776_1893; phage(gi148717907) 2e-31 Click
581773764..1774063 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp62; HMPREF0776_1894; phage(gi122891846) 1e-50 Click
591774200..1776074 PHAGE_Staphy_92: ORF004; HMPREF0776_1895; phage(gi66396410) 0.0 Click
601776087..1777259 PHAGE_Staphy_phiNM: tail fiber; HMPREF0776_1896; phage(gi118430785) 0.0 Click
611777265..1777660 PHAGE_Staphy_phiMR11: hypothetical protein; HMPREF0776_1897; phage(gi162290171) 3e-71 Click
621777716..1777991 PHAGE_Staphy_phiETA3: holin protein; HMPREF0776_1898; phage(gi122891850) 1e-48 Click
631777969..1779390 PHAGE_Staphy_phiETA3: amidase; HMPREF0776_1899; phage(gi122891851) 0.0 Click
64complement(1779450..1780007) PHAGE_Staphy_71: ORF024; HMPREF0776_1900; phage(gi66396064) 5e-99 Click
651780382..1780534 conserved hypothetical protein; HMPREF0776_1901 0.0 Click
661780702..1780902 PHAGE_Staphy_55: ORF073; HMPREF0776_1902; phage(gi66396175) 3e-28 Click
67complement(1780990..1781127) PHAGE_Staphy_55: ORF137; HMPREF0776_1903; phage(gi66396186) 2e-18 Click
681781608..1782165 PHAGE_Lister_A500: gp26; HMPREF0776_1904; phage(gi157324986) 9e-18 Click
691782429..1782482 attR    TCGAAATGGAAGGTAGTATTGGATAGCTTTAAACCGCGTTGTTAAGCCATTCTT 0.0 Click

Region 4, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12199563..2200903 PHAGE_Megavi_lba: putative glutamine synthetase; HMPREF0776_2310; phage(gi448825676) 1e-12 Click
22201407..2201604 PHAGE_Staphy_55: ORF073; HMPREF0776_2311; phage(gi66396175) 1e-06 Click
32202306..2202518 PHAGE_Staphy_55: ORF073; HMPREF0776_2312; phage(gi66396175) 2e-07 Click
42202812..2203018 PHAGE_Staphy_phiMR11: hypothetical protein; HMPREF0776_2313; phage(gi162290174) 8e-17 Click
52203719..2203829 conserved hypothetical protein; HMPREF0776_2314 0.0 Click
62204257..2204442 PHAGE_Staphy_55: ORF073; HMPREF0776_2315; phage(gi66396175) 6e-22 Click
72204953..2205057 conserved hypothetical protein; HMPREF0776_2316 0.0 Click
82205093..2205185 conserved hypothetical protein; HMPREF0776_2317 0.0 Click
92205186..2205437 conserved hypothetical protein; HMPREF0776_2318 0.0 Click
102205642..2206346 PHAGE_Staphy_StB27: minor head protein; HMPREF0776_2319; phage(gi431809708) 2e-11 Click
112206343..2206474 conserved hypothetical protein; HMPREF0776_2320 0.0 Click
122206634..2206846 PHAGE_Staphy_StB27: scaffold protein; HMPREF0776_2321; phage(gi431809709) 3e-13 Click
132206966..2207235 conserved hypothetical protein; HMPREF0776_2322 0.0 Click
142207248..2207370 conserved hypothetical protein; HMPREF0776_2323 0.0 Click
152207573..2207707 PHAGE_Staphy_StB27: minor head protein; HMPREF0776_2324; phage(gi431809708) 5e-12 Click
162207914..2208087 conserved hypothetical protein; HMPREF0776_2325 0.0 Click
172208098..2208292 conserved hypothetical protein; HMPREF0776_2326 0.0 Click
182208552..2208746 hypothetical protein; HMPREF0776_2327 0.0 Click
192208849..2209202 PHAGE_Clostr_phiC2: putative head morphogenesis protein; HMPREF0776_2328; phage(gi134287339) 7e-08 Click

Region 5, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12741212..2741224 attL    TCAAATCAAGGAG 0.0 Click
2complement(2749721..2750575) PHAGE_Clostr_phiZP2: putative lysozyme-peptidase; HMPREF0776_2842; phage(gi392972703) 2e-09 Click
3complement(2750825..2752054) PHAGE_Cafete_BV_PW1: putative DNA N6-adenine methyltransferase; HMPREF0776_2843; phage(gi310831004) 2e-12 Click
4complement(2752047..2753786) PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; HMPREF0776_2844; phage(gi423261981) 1e-22 Click
5complement(2753966..2754685) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2845; phage(gi17426294) 4e-06 Click
6complement(2754836..2755552) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2846; phage(gi17426294) 6e-11 Click
7complement(2755733..2756443) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2847; phage(gi17426294) 2e-13 Click
8complement(2756540..2757259) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2848; phage(gi17426294) 2e-12 Click
9complement(2757317..2758081) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2849; phage(gi17426294) 1e-16 Click
10complement(2758164..2758856) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; HMPREF0776_2850; phage(gi17426294) 1e-12 Click
112759970..2760407 PHAGE_Staphy_71: ORF024; HMPREF0776_2851; phage(gi66396064) 2e-18 Click
12complement(2760881..2761153) conserved hypothetical protein; HMPREF0776_2852 0.0 Click
132761355..2761690 conserved hypothetical protein; HMPREF0776_2853 0.0 Click
142761687..2761827 conserved hypothetical protein; HMPREF0776_2854 0.0 Click
152761832..2762623 PHAGE_Staphy_37: ORF014; HMPREF0776_2855; phage(gi66395743) 2e-11 Click
16complement(2762610..2762735) hypothetical protein; HMPREF0776_2856 0.0 Click
17complement(2762993..2763976) PHAGE_Staphy_phi5967PVL: Panton-Valentine leukocidin chain S; HMPREF0776_2857; phage(gi431810286) 2e-159 Click
18complement(2763978..2764913) PHAGE_Staphy_phi5967PVL: Panton-Valentine leukocidin chain S; HMPREF0776_2858; phage(gi431810285) 4e-124 Click
19complement(2765591..2765710) hypothetical protein; HMPREF0776_2859 0.0 Click
202765807..2766052 conserved hypothetical protein; HMPREF0776_2860 0.0 Click
212766306..2766422 conserved hypothetical protein; HMPREF0776_2861 0.0 Click
222766521..2767117 conserved hypothetical protein; HMPREF0776_2862 0.0 Click
232767284..2768630 PHAGE_Strept_1: hypothetical protein EJ-1p03; HMPREF0776_2863; phage(gi39653677) 8e-86 Click
242769154..2769453 conserved hypothetical protein; HMPREF0776_2864 0.0 Click
252769459..2770250 PHAGE_Lactob_Lj965: hypothetical protein Ljo_0291; HMPREF0776_2865; phage(gi41179221) 2e-26 Click
262770648..2771142 PHAGE_Staphy_phiMR11: hypothetical protein; HMPREF0776_2866; phage(gi162290109) 6e-14 Click
272771291..2771303 attR    TCAAATCAAGGAG 0.0 Click
282771359..2772264 PHAGE_Staphy_vB_SepiS_phiIPLA5: integrase; HMPREF0776_2867; phage(gi399528924) 8e-158 Click