Listeria monocytogenes J2818 .1, whole genome shotgun [asmbl_id: NC_000000].2973040, GC%: 37.76%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2102231..2104012) PHAGE_Bacill_SPBc2: ABC transporter; LMPG_02167; phage(gi9630145) 7e-35 Click
2complement(2104005..2105771) PHAGE_Bacill_SPBc2: ABC transporter; LMPG_02168; phage(gi9630145) 1e-30 Click
32105890..2106723 transcriptional regulator; LMPG_02169 0.0 Click
42106759..2107874 PHAGE_Acanth_moumouvirus: putative triacylglycerol lipase; LMPG_02170; phage(gi441432487) 8e-20 Click
52107981..2108688 EAL domain-containing protein; LMPG_02171 0.0 Click
6complement(2108658..2109353) conserved hypothetical protein; LMPG_02172 0.0 Click
7complement(2109572..2110024) PHAGE_Lister_A118: gp35; LMPG_02173; phage(gi16798818) 3e-29 Click
8complement(2110030..2110365) PHAGE_Staphy_92: ORF019; LMPG_02174; phage(gi66396425) 4e-15 Click
92110582..2111010 PHAGE_Lister_A118: gp61; LMPG_02175; phage(gi16798848) 6e-16 Click
102111022..2111438 PHAGE_Lister_A118: gp66; LMPG_02176; phage(gi16798853) 2e-22 Click
112111716..2112105 PHAGE_Strept_5: hypothetical protein SpyM3_1317; LMPG_02177; phage(gi28876399) 8e-06 Click
122112118..2112630 PHAGE_Clostr_phi8074_B1: putative phage major tail protein; LMPG_02178; phage(gi431810369) 5e-19 Click
132112678..2112980 PHAGE_Strept_5: hypothetical protein SpyM3_1315; LMPG_02179; phage(gi28876397) 9e-08 Click
142113034..2113426 PHAGE_Strept_5: hypothetical protein SpyM3_1314; LMPG_02180; phage(gi28876396) 5e-24 Click
152113413..2115281 PHAGE_Propio_PAD20: Gp14; LMPG_02181; phage(gi330858412) 6e-48 Click
162115278..2116096 PHAGE_Lister_A118: gp17; LMPG_02182; phage(gi16798800) 3e-44 Click
172116106..2117242 PHAGE_Lister_A118: gp18; LMPG_02183; phage(gi16798801) 1e-48 Click
182117232..2117531 PHAGE_Deep_s_D6E: tail fiber protein; LMPG_02184; phage(gi423262345) 5e-05 Click
192117546..2118121 conserved hypothetical protein; LMPG_02185 0.0 Click
202118136..2118615 PHAGE_Deep_s_D6E: tail fiber protein; LMPG_02186; phage(gi423262345) 1e-06 Click
212118612..2119148 PHAGE_Lister_A118: gp20; LMPG_02187; phage(gi16798803) 4e-05 Click
222119167..2119589 PHAGE_Bacill_WBeta: phage holin; LMPG_02188; phage(gi85701395) 6e-32 Click
232119570..2120298 PHAGE_Bacill_SPP1: hypothetical protein SPP1p051; LMPG_02189; phage(gi22855096) 5e-37 Click
24complement(2120337..2122685) PROPHAGE_Pseudo_PAO1: coat protein A of bacteriophage Pf1; LMPG_02190; phage(gi15595921) 3e-08 Click
252122879..2123628 EAL domain-containing protein; LMPG_02191 0.0 Click
26complement(2123698..2125206) PHAGE_Staphy_42E: ORF012; LMPG_02192; phage(gi66395520) 3e-18 Click

Region 2, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12717490..2717536 attL    AGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG 0.0 Click
22717961..2718224 PHAGE_Lister_A511: gp188; LMPG_02782; phage(gi157325143) 2e-09 Click
32718229..2718678 PHAGE_Lister_A006: gp23; LMPG_02783; phage(gi157325438) 1e-64 Click
4complement(2718752..2719351) PHAGE_Lister_A118: gp27; LMPG_02784; phage(gi16798810) 8e-114 Click
5complement(2719338..2719520) PHAGE_Lister_A118: gp26; LMPG_02785; phage(gi16798809) 7e-27 Click
6complement(2719753..2720460) PHAGE_Lister_A006: PlyA006; LMPG_02786; phage(gi157325435) 1e-134 Click
7complement(2720460..2720741) PHAGE_Lister_A006: Hol; LMPG_02787; phage(gi157325433) 6e-49 Click
8complement(2720741..2721046) PHAGE_Lister_A006: gp18; LMPG_02788; phage(gi157325432) 4e-50 Click
9complement(2721097..2723259) PHAGE_Lister_A006: gp17; LMPG_02789; phage(gi157325431) 0.0 Click
10complement(2723272..2724840) PHAGE_Lister_A006: gp16; LMPG_02790; phage(gi157325430) 0.0 Click
11complement(2724837..2729627) PHAGE_Lister_A006: gp15; LMPG_02791; phage(gi157325429) 0.0 Click
12complement(2729632..2729907) PHAGE_Lister_A006: gp14; LMPG_02792; phage(gi157325428) 8e-44 Click
13complement(2729940..2730371) PHAGE_Lister_A006: gp13; LMPG_02793; phage(gi157325427) 2e-72 Click
14complement(2730420..2730692) PHAGE_Lister_A006: Tsh; LMPG_02794; phage(gi157325426) 2e-15 Click
15complement(2730682..2731113) PHAGE_Lister_A006: Tsh; LMPG_02795; phage(gi157325426) 2e-61 Click
16complement(2731085..2731489) PHAGE_Lister_A006: gp11; LMPG_02796; phage(gi157325425) 2e-65 Click
17complement(2731486..2731803) PHAGE_Lister_A006: gp10; LMPG_02797; phage(gi157325424) 2e-51 Click
18complement(2731793..2732158) PHAGE_Lister_A006: gp9; LMPG_02798; phage(gi157325484) 4e-64 Click
19complement(2732158..2732511) PHAGE_Lister_A006: gp8; LMPG_02799; phage(gi157325483) 6e-63 Click
20complement(2732512..2732667) PHAGE_Lister_A006: gp7; LMPG_02800; phage(gi157325482) 9e-13 Click
21complement(2732681..2733553) PHAGE_Lister_A006: Cps; LMPG_02801; phage(gi157325479) 7e-143 Click
22complement(2733576..2734130) PHAGE_Lister_A006: gp5; LMPG_02802; phage(gi157325467) 7e-103 Click
23complement(2734226..2735269) PHAGE_Lister_A006: gp4; LMPG_02803; phage(gi157325456) 0.0 Click
24complement(2735274..2736830) PHAGE_Lister_A006: gp3; LMPG_02804; phage(gi157325445) 0.0 Click
25complement(2736845..2738173) PHAGE_Lister_A006: TerL; LMPG_02805; phage(gi157325434) 0.0 Click
26complement(2738103..2738888) PHAGE_Lister_A006: TerS; LMPG_02806; phage(gi157325423) 8e-132 Click
27complement(2738928..2739155) PHAGE_Lister_A006: gp62; LMPG_02807; phage(gi157325481) 3e-33 Click
28complement(2739701..2740303) conserved hypothetical protein; LMPG_02808 0.0 Click
29complement(2740330..2740767) PHAGE_Lister_A006: gp59; LMPG_02809; phage(gi157325477) 2e-69 Click
30complement(2740933..2741319) PHAGE_Lister_A500: gp59; LMPG_02810; phage(gi157325018) 2e-45 Click
31complement(2741323..2741727) PHAGE_Lister_A500: gp58; LMPG_02811; phage(gi157325017) 1e-61 Click
32complement(2741672..2741863) PHAGE_Lister_A500: gp57; LMPG_02812; phage(gi157325016) 2e-28 Click
33complement(2741882..2742361) PHAGE_Lister_A006: gp53; LMPG_02813; phage(gi157325471) 5e-83 Click
34complement(2742361..2742861) conserved hypothetical protein; LMPG_02814 0.0 Click
35complement(2742858..2743259) PHAGE_Lister_A006: gp52; LMPG_02815; phage(gi157325470) 3e-47 Click
36complement(2743256..2743516) conserved hypothetical protein; LMPG_02816 0.0 Click
37complement(2743516..2743722) PHAGE_Lister_A511: gp20; LMPG_02817; phage(gi157325165) 9e-26 Click
38complement(2743719..2744204) PHAGE_Lister_A500: gp54; LMPG_02818; phage(gi157325013) 6e-56 Click
39complement(2744201..2744410) PHAGE_Lister_A006: gp48; LMPG_02819; phage(gi157325465) 2e-30 Click
40complement(2744407..2744814) PHAGE_Lister_A500: gp52; LMPG_02820; phage(gi157325010) 1e-12 Click
41complement(2744811..2744999) conserved hypothetical protein; LMPG_02821 0.0 Click
42complement(2744992..2745594) PHAGE_Lister_A006: gp45; LMPG_02822; phage(gi157325462) 5e-38 Click
43complement(2745591..2745800) PHAGE_Lister_A500: gp48; LMPG_02823; phage(gi157325007) 6e-30 Click
44complement(2745797..2746090) PHAGE_Lister_A500: gp47; LMPG_02824; phage(gi157325006) 2e-50 Click
45complement(2746107..2746304) conserved hypothetical protein; LMPG_02825 0.0 Click
46complement(2746308..2747213) PHAGE_Lister_A006: gp43; LMPG_02826; phage(gi157325460) 3e-79 Click
47complement(2747251..2748162) PHAGE_Lactob_LF1: RecT protein; LMPG_02827; phage(gi418489428) 1e-12 Click
48complement(2748155..2749666) PHAGE_Lister_B054: gp49; LMPG_02828; phage(gi157325333) 8e-34 Click
49complement(2749899..2750087) PHAGE_Lister_A006: gp39; LMPG_02829; phage(gi157325455) 5e-22 Click
50complement(2750190..2750396) conserved hypothetical protein; LMPG_02830 0.0 Click
51complement(2750386..2750916) PHAGE_Lister_A006: gp37; LMPG_02831; phage(gi157325453) 2e-81 Click
52complement(2751040..2751816) PHAGE_Lister_A500: gp37; LMPG_02832; phage(gi157324996) 1e-120 Click
53complement(2751798..2752073) conserved hypothetical protein; LMPG_02833 0.0 Click
542751880..2752077 PHAGE_Lister_A118: gp41-1; LMPG_02834; phage(gi16798828) 1e-32 Click
55complement(2752079..2752360) PHAGE_Lister_A006: gp34; LMPG_02835; phage(gi157325450) 4e-41 Click
56complement(2752386..2752670) conserved hypothetical protein; LMPG_02836 0.0 Click
57complement(2752682..2752876) conserved hypothetical protein; LMPG_02837 0.0 Click
58complement(2752897..2753106) PHAGE_Bacill_1: Predicted transcription regulator; LMPG_02838; phage(gi158348425) 9e-05 Click
592753272..2753694 PHAGE_Geobac_GBSV1: immunity repressor protein; LMPG_02839; phage(gi115334658) 3e-26 Click
602753710..2754135 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp47; LMPG_02840; phage(gi115334657) 3e-25 Click
612754150..2754857 conserved hypothetical protein; LMPG_02841 0.0 Click
622754916..2755521 PHAGE_Lister_A006: gp15; LMPG_02842; phage(gi157325429) 2e-17 Click
632755566..2756747 PHAGE_Strept_6: putative integrase; LMPG_02843; phage(gi28876488) 3e-25 Click
64complement(2756838..2756910) tRNA 0.0 Click
652756838..2756884 attR    AGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG 0.0 Click
66complement(2757062..2758309) PHAGE_Equid__1: envelope glycoprotein J; LMPG_02844; phage(gi50313312) 4e-06 Click
672758587..2759447 glucose uptake protein; LMPG_02845 0.0 Click
682759519..2761513 PHAGE_Acanth_mimivirus: methionyl-tRNA synthetase; LMPG_02846; phage(gi311978039) 4e-36 Click

Region 3, total : 74 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12810608..2812683 PROPHAGE_Escher_Sakai: ATP-dependent metalloprotease; LMPG_02890; phage(gi15833311) 1e-170 Click
22812799..2813578 conserved hypothetical protein; LMPG_02891 0.0 Click
32813594..2814478 redox-regulated chaperone protein; LMPG_02892 0.0 Click
42814464..2814475 attL    GAAGAAGCAAAA 0.0 Click
52814594..2815520 PHAGE_Lactoc_P087: putative cysteine synthase; LMPG_02893; phage(gi229605000) 1e-95 Click
6complement(2815714..2815911) PHAGE_Lister_B025: gp33; LMPG_02894; phage(gi157325249) 1e-17 Click
7complement(2815908..2816141) PHAGE_Lister_2389: Gp22 protein; LMPG_02895; phage(gi17488527) 6e-38 Click
82816420..2816674 PHAGE_Lister_A006: gp25; LMPG_02896; phage(gi157325440) 6e-26 Click
92816703..2817074 PHAGE_Lister_A118: gp29; LMPG_02897; phage(gi16798812) 1e-27 Click
102817080..2817529 PHAGE_Lister_A118: gp28; LMPG_02898; phage(gi16798811) 4e-67 Click
112817554..2818051 PHAGE_Lister_A006: gp22; LMPG_02899; phage(gi157325437) 2e-91 Click
122818326..2819099 PHAGE_Lister_A006: gp21; LMPG_02900; phage(gi157325436) 8e-152 Click
13complement(2819140..2819985) PHAGE_Lister_A118: L-alanoyl-D-glutamate peptidase; LMPG_02901; phage(gi16798808) 2e-158 Click
14complement(2819985..2820275) PHAGE_Lister_A118: holin; LMPG_02902; phage(gi16798807) 4e-49 Click
15complement(2820279..2820644) PHAGE_Lister_A118: gp23; LMPG_02903; phage(gi16798806) 8e-63 Click
16complement(2820673..2820831) PHAGE_Lister_A118: gp22; LMPG_02904; phage(gi16798805) 2e-22 Click
17complement(2820836..2821153) PHAGE_Lister_A118: gp21; LMPG_02905; phage(gi16798804) 3e-52 Click
18complement(2821165..2822238) PHAGE_Lister_A118: gp20; LMPG_02906; phage(gi16798803) 0.0 Click
19complement(2822238..2823266) PHAGE_Lister_A118: gp19; LMPG_02907; phage(gi16798802) 0.0 Click
20complement(2823267..2824292) PHAGE_Lister_A118: gp18; LMPG_02908; phage(gi16798801) 0.0 Click
21complement(2824301..2825119) PHAGE_Lister_A118: gp17; LMPG_02909; phage(gi16798800) 3e-148 Click
22complement(2825121..2830484) PHAGE_Lister_A118: putative tape-measure protein; LMPG_02910; phage(gi16798799) 0.0 Click
23complement(2830495..2831100) PHAGE_Lister_A118: gp15; LMPG_02911; phage(gi16798798) 9e-113 Click
24complement(2831105..2831527) PHAGE_Lister_A118: gp14; LMPG_02912; phage(gi16798797) 4e-71 Click
25complement(2831579..2831911) PHAGE_Lister_A118: gp13; LMPG_02913; phage(gi16798796) 3e-42 Click
26complement(2831841..2832275) PHAGE_Lister_A118: major tail shaft protein; LMPG_02914; phage(gi16798795) 1e-78 Click
27complement(2832278..2832685) PHAGE_Lister_A118: gp11; LMPG_02915; phage(gi16798794) 5e-70 Click
28complement(2832685..2833023) PHAGE_Lister_A118: gp10; LMPG_02916; phage(gi16798793) 2e-60 Click
29complement(2833023..2833385) PHAGE_Lister_A118: gp9; LMPG_02917; phage(gi16798792) 8e-62 Click
30complement(2833385..2833780) PHAGE_Lister_A118: gp8; LMPG_02918; phage(gi16798791) 5e-67 Click
31complement(2833799..2834800) PHAGE_Strept_1: major head protein; LMPG_02919; phage(gi39653721) 2e-113 Click
32complement(2834800..2835390) PHAGE_Lister_A118: putative scaffolding protein; LMPG_02920; phage(gi16798788) 1e-81 Click
33complement(2835481..2836608) PHAGE_Lister_A118: gp4; LMPG_02921; phage(gi16798787) 0.0 Click
34complement(2836609..2838369) PHAGE_Lister_A118: putative portal protein; LMPG_02922; phage(gi16798786) 0.0 Click
35complement(2838382..2839692) PHAGE_Strept_5093: putative terminase large subunit; LMPG_02923; phage(gi238801895) 1e-176 Click
36complement(2839685..2840440) PHAGE_Bacill_BCJA1c: terminase small subunit; LMPG_02924; phage(gi56694901) 3e-49 Click
37complement(2840486..2841025) phage protein; LMPG_02925 0.0 Click
38complement(2841285..2841719) PHAGE_Lister_A118: gp66; LMPG_02926; phage(gi16798853) 1e-75 Click
39complement(2841738..2841902) PHAGE_Lister_A118: gp65; LMPG_02927; phage(gi16798852) 3e-21 Click
40complement(2841914..2842039) PHAGE_Lister_A118: gp64; LMPG_02928; phage(gi16798851) 5e-16 Click
41complement(2842032..2842436) PHAGE_Lister_A118: gp63; LMPG_02929; phage(gi16798850) 1e-73 Click
42complement(2842539..2842859) PHAGE_Lister_A118: gp61; LMPG_02930; phage(gi16798848) 4e-49 Click
43complement(2842872..2843255) conserved hypothetical protein; LMPG_02931 0.0 Click
44complement(2843271..2843750) PHAGE_Lister_A118: putative SSB protein; LMPG_02932; phage(gi16798847) 8e-85 Click
45complement(2843750..2843929) conserved hypothetical protein; LMPG_02933 0.0 Click
46complement(2843926..2844396) PHAGE_Lister_A500: gp54; LMPG_02934; phage(gi157325013) 6e-59 Click
47complement(2844393..2844836) PHAGE_Lister_A500: gp52; LMPG_02935; phage(gi157325010) 3e-47 Click
48complement(2844833..2845030) conserved hypothetical protein; LMPG_02936 0.0 Click
49complement(2845033..2845629) PHAGE_Lister_A118: gp51; LMPG_02937; phage(gi16798838) 6e-45 Click
50complement(2845641..2846624) PHAGE_Entero_phiFL3A: DNA cytosine methyltransferase; LMPG_02938; phage(gi281416239) 3e-48 Click
51complement(2846621..2846875) PHAGE_Lister_2389: Gp32 protein; LMPG_02939; phage(gi17488537) 2e-39 Click
52complement(2846872..2847801) PHAGE_Lister_A118: gp49; LMPG_02940; phage(gi16798836) 2e-20 Click
53complement(2847822..2848535) PHAGE_Strept_3: hypothetical protein SpyM3_1132; LMPG_02941; phage(gi28876302) 7e-35 Click
54complement(2848585..2849466) conserved hypothetical protein; LMPG_02942 0.0 Click
55complement(2849463..2849666) phage protein; LMPG_02943 0.0 Click
56complement(2849884..2850072) PHAGE_Lister_A118: gp45; LMPG_02944; phage(gi16798832) 2e-24 Click
57complement(2850181..2850396) PHAGE_Lister_A118: gp44; LMPG_02945; phage(gi16798831) 4e-30 Click
58complement(2850393..2850926) PHAGE_Lister_A118: gp43; LMPG_02946; phage(gi16798830) 2e-77 Click
59complement(2851047..2851826) PHAGE_Lister_A118: putative anti-repressor promoter; LMPG_02947; phage(gi16798829) 6e-119 Click
602851890..2852132 conserved hypothetical protein; LMPG_02948 0.0 Click
61complement(2852125..2852286) conserved hypothetical protein; LMPG_02949 0.0 Click
62complement(2852318..2852599) PHAGE_Lister_A118: gp41; LMPG_02950; phage(gi16798827) 7e-40 Click
63complement(2852625..2852909) conserved hypothetical protein; LMPG_02951 0.0 Click
64complement(2852921..2853115) conserved hypothetical protein; LMPG_02952 0.0 Click
652853181..2853411 PHAGE_Lister_A118: gp37-1; LMPG_02953; phage(gi16798822) 2e-38 Click
66complement(2853340..2853606) PHAGE_Lister_A118: gp37; LMPG_02954; phage(gi16798821) 6e-44 Click
67complement(2853610..2853852) PHAGE_Lister_A118: putative repressor protein; LMPG_02955; phage(gi16798820) 6e-39 Click
682853978..2854283 PHAGE_Lister_A118: putative repressor protein; LMPG_02956; phage(gi16798819) 1e-51 Click
692854316..2854807 PHAGE_Lister_A118: gp35; LMPG_02957; phage(gi16798818) 2e-94 Click
702854830..2855048 PHAGE_Lister_A118: gp34; LMPG_02958; phage(gi16798817) 2e-38 Click
712855064..2855786 PHAGE_Lister_A118: gp33; LMPG_02959; phage(gi16798816) 2e-133 Click
722855808..2856548 PHAGE_Lister_A118: gp32; LMPG_02960; phage(gi16798815) 2e-138 Click
732857125..2857136 attR    GAAGAAGCAAAA 0.0 Click
742857297..2857971 PHAGE_Lister_A118: putative integrase; LMPG_02961; phage(gi16798814) 9e-123 Click
752858016..2858438 competence transcription factor; LMPG_02962 0.0 Click
76complement(2858493..2858849) PHAGE_Clostr_PhiS63: gp36; LMPG_02963; phage(gi388570662) 4e-07 Click