Yersinia intermedia ATCC 29909 , whole genome shotgun [asmbl_id: NC_000000].4711317, GC%: 47.44%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1439577..439975 PHAGE_Salmon_ST160: Gp19; yinte0001_26850; phage(gi318065944) 4e-39 Click
2439993..440493 PHAGE_Yersin_PY54: hypothetical protein PY54p62; yinte0001_26860; phage(gi33770571) 6e-76 Click
3440711..440833 hypothetical protein; yinte0001_26870 0.0 Click
4441000..441119 hypothetical protein; yinte0001_26880 0.0 Click
5441220..441462 hypothetical protein; yinte0001_26890 0.0 Click
6441608..441853 PHAGE_Salmon_ST160: hypothetical protein; yinte0001_26900; phage(gi318065946) 2e-11 Click
7442769..444871 PHAGE_Entero_c_1: terminase large subunit; yinte0001_26920; phage(gi428781737) 0.0 Click
8445083..446564 PHAGE_Entero_c_1: portal protein; yinte0001_26940; phage(gi428781739) 0.0 Click
9446605..448548 PHAGE_Entero_c_1: head maturation protease; yinte0001_26950; phage(gi428781740) 0.0 Click
10448631..448957 PHAGE_Entero_c_1: hypothetical protein; yinte0001_26960; phage(gi428781741) 5e-28 Click
11448983..449225 PHAGE_Entero_c_1: hypothetical protein; yinte0001_26970; phage(gi428781742) 5e-15 Click
12449237..449791 PHAGE_Entero_c_1: minor tail protein; yinte0001_26980; phage(gi428781743) 3e-53 Click
13449986..450192 PHAGE_Entero_c_1: tail protein; yinte0001_26990; phage(gi428781744) 7e-20 Click
14450437..450739 PHAGE_Entero_mEp390: major tail subunit; yinte0001_27000; phage(gi428782674) 1e-23 Click
15450821..451174 PHAGE_Cronob_ENT39118: phage tail assembly chaperone; yinte0001_27010; phage(gi431811075) 9e-28 Click
16451491..454793 PHAGE_Entero_HK544: tail length tape measure protein; yinte0001_27030; phage(gi428783229) 5e-96 Click
17455296..455736 PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp20; yinte0001_27050; phage(gi209552439) 9e-25 Click
18455927..456127 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; yinte0001_27060; phage(gi374531669) 1e-08 Click
19456190..459204 PHAGE_Pseudo_vB_PaeS_PMG1: putative tail protein; yinte0001_27070; phage(gi374531670) 9e-73 Click

Region 2, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1455291..455302 attL    CAGAAGTGATTA 0.0 Click
2complement(464000..464932) PHAGE_Entero_mEpX1: hypothetical protein; yinte0001_27100; phage(gi428781913) 7e-102 Click
3464974..465156 hypothetical protein; yinte0001_27110 0.0 Click
4complement(465894..466139) PHAGE_Entero_mEp237: hypothetical protein; yinte0001_27120; phage(gi435439313) 1e-15 Click
5complement(467763..469208) PHAGE_Salmon_ST160: GtrC; yinte0001_27130; phage(gi318065902) 9e-52 Click
6complement(469225..470151) PHAGE_Salmon_ST160: GtrB; yinte0001_27140; phage(gi318065903) 6e-149 Click
7complement(470849..471133) PHAGE_Salmon_ST160: Int; yinte0001_27150; phage(gi318065905) 5e-37 Click
8471382..471618 PHAGE_Cronob_phiES15: terminase large subunit; yinte0001_27160; phage(gi401817592) 4e-34 Click
9471654..471872 PHAGE_Escher_TL_2011b: hypothetical protein; yinte0001_27170; phage(gi418487677) 1e-20 Click
10472211..472999 PHAGE_Escher_TL_2011b: hypothetical protein; yinte0001_27180; phage(gi418487677) 1e-102 Click
11473032..474213 PHAGE_Acidia_two_tailed_virus: hypothetical protein ATV_gp34; yinte0001_27190; phage(gi75750403) 9e-09 Click
12474558..476846 PHAGE_Parame_bursaria_Chlorella_virus_AR158: hypothetical protein AR158_C785L; yinte0001_27200; phage(gi157953975) 1e-22 Click
13484673..484684 attR    CAGAAGTGATTA 0.0 Click

Region 3, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11468404..1469135 PHAGE_Cafete_BV_PW1: putative ABC-type amino acid transporter; yinte0001_13720; phage(gi310831221) 7e-08 Click
21469201..1469274 tRNA 0.0 Click
31469285..1469370 tRNA 0.0 Click
41469426..1469449 attL    GGCGGTTTTTTTGTGCCTGAAATC 0.0 Click
5complement(1469474..1469755) PHAGE_Entero_mEp390: integrase; yinte0001_19310; phage(gi428782691) 1e-36 Click
61469891..1470094 PHAGE_Escher_HK639: rha protein; yinte0001_19320; phage(gi356870673) 1e-20 Click
7complement(1470872..1471159) PHAGE_Salmon_RE_2010: major tail sheath protein; yinte0001_19330; phage(gi418489720) 9e-36 Click
8complement(1471881..1472000) hypothetical protein; yinte0001_19340 0.0 Click
9complement(1472322..1473257) PROPHAGE_Escher_MG1655: predicted transposase; yinte0001_19350; phage(gi16131287) 3e-88 Click
10complement(1473424..1473600) PHAGE_Sodali_phiSG1: transposase; yinte0001_19360; phage(gi89886005) 4e-06 Click
11complement(1474154..1474426) PHAGE_Salmon_SP_004: phage baseplate assembly protein; yinte0001_19370; phage(gi526003627) 7e-22 Click
12complement(1474481..1474606) PHAGE_Salmon_RE_2010: baseplate assembly protein V; yinte0001_19380; phage(gi418489709) 2e-05 Click
13complement(1474943..1475644) hypothetical protein; yinte0001_19390 0.0 Click
141475724..1475963 hypothetical protein; yinte0001_19400 0.0 Click
15complement(1475979..1476215) PHAGE_Salmon_RE_2010: tail completion protein; yinte0001_19410; phage(gi418489707) 3e-16 Click
161476295..1476318 attR    GGCGGTTTTTTTGTGCCTGAAATC 0.0 Click

Region 4, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13643218..3643229 attL    CCCAAAGTCATT 0.0 Click
2complement(3644518..3645501) PHAGE_Ostreo_OlV5: 6-phosphofructokinase; yinte0001_39250; phage(gi472341206) 7e-18 Click
3complement(3645720..3646622) Ferrous-iron efflux pump fieF; yinte0001_39260 0.0 Click
4complement(3647052..3647252) PHAGE_Salmon_SP_004: baseplate wedge subunit; yinte0001_39270; phage(gi526003628) 1e-06 Click
53647697..3647996 PHAGE_Entero_N15: gp48; yinte0001_39280; phage(gi9630515) 1e-07 Click
63648128..3648250 PHAGE_Salmon_SP_004: integrase; yinte0001_39290; phage(gi526003641) 2e-11 Click
7complement(3648431..3648931) Periplasmic repressor of cpx regulon by interaction with CpxA, rescue from transitory stresses; yinte0001_39300 0.0 Click
83649115..3649813 PHAGE_Feldma_species_virus: putative sensor histidine kinase; yinte0001_39310; phage(gi197322366) 9e-10 Click
93649873..3651186 PHAGE_Ectoca_siliculosus_virus_1: EsV-1-65; yinte0001_39320; phage(gi13242537) 3e-08 Click
10complement(3651235..3652338) PHAGE_Acanth_mimivirus: probable methylated-DNA--protein-cysteine methyltransferase; yinte0001_39330; phage(gi311978100) 4e-21 Click
113660848..3660859 attR    CCCAAAGTCATT 0.0 Click