# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | 348376..348387 | attL CGGAATTTTTCA | 0.0 | Click |
2 | 356141..356326 | PHAGE_Pseudo_phi297: global regulatory protein; yfred0001_18900; phage(gi374531265) | 6e-14 | Click |
3 | 356690..356782 | tRNA | 0.0 | Click |
4 | complement(356929..357144) | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); yfred0001_3940; phage(gi169936018) | 7e-19 | Click |
5 | complement(357219..358319) | PHAGE_Entero_2: P2 gpD-like tail protein; yfred0001_3950; phage(gi169936019) | 1e-138 | Click |
6 | complement(358322..358786) | PHAGE_Entero_2: P2 gpU-like tail protein; yfred0001_3960; phage(gi169936020) | 1e-50 | Click |
7 | complement(358798..361644) | PHAGE_Entero_2: P2 gpT-like tail protein; yfred0001_3970; phage(gi169936021) | 1e-111 | Click |
8 | complement(361709..361828) | PHAGE_Entero_2: P2 gpE-like protein; yfred0001_3980; phage(gi169936022) | 5e-08 | Click |
9 | complement(361843..362271) | PHAGE_Entero_2: P2 gpE-like tail protein; yfred0001_3990; phage(gi169936023) | 1e-20 | Click |
10 | complement(362273..362788) | PHAGE_Entero_2: P2 gpFII-like protein; yfred0001_4000; phage(gi169936024) | 6e-61 | Click |
11 | complement(362800..363975) | PHAGE_Entero_2: P2 gpFI-like protein; yfred0001_4010; phage(gi169936025) | 0.0 | Click |
12 | complement(364113..364295) | hypothetical protein; yfred0001_4020 | 0.0 | Click |
13 | complement(364309..365736) | PHAGE_Entero_2: P2 gpH-like protein; yfred0001_4030; phage(gi169936030) | 1e-68 | Click |
14 | complement(365739..366278) | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; yfred0001_4040; phage(gi169936031) | 1e-64 | Click |
15 | complement(366340..367248) | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; yfred0001_4050; phage(gi169936032) | 1e-114 | Click |
16 | complement(367601..368236) | PHAGE_Erwini_ENT90: baseplate assembly protein; yfred0001_4070; phage(gi431810950) | 6e-57 | Click |
17 | complement(368401..368808) | PHAGE_Entero_2: P2 gpS-like tail completion protein; yfred0001_4080; phage(gi169936035) | 2e-32 | Click |
18 | complement(368844..369311) | PHAGE_Erwini_ENT90: phage tail completion protein; yfred0001_4090; phage(gi431810962) | 4e-43 | Click |
19 | complement(369425..369838) | PHAGE_Entero_2: P2 LysB-like protein; yfred0001_4100; phage(gi169936038) | 3e-23 | Click |
20 | complement(369842..370183) | PHAGE_Pectob_phiTE: endolysin; yfred0001_4110; phage(gi448244889) | 5e-43 | Click |
21 | complement(370224..370604) | PHAGE_Aeromo_phiO18P: putative holin; yfred0001_4120; phage(gi148727161) | 3e-07 | Click |
22 | complement(370845..371336) | PHAGE_Entero_2: P2 gpL-like protein; yfred0001_4140; phage(gi169936044) | 2e-31 | Click |
23 | complement(371435..372091) | PHAGE_Erwini_ENT90: terminase endonuclease subunit; yfred0001_4150; phage(gi431810947) | 3e-47 | Click |
24 | complement(372098..373099) | PHAGE_Entero_2: P2 gpN-like major capsid protein; yfred0001_4160; phage(gi169936046) | 2e-117 | Click |
25 | complement(373189..374094) | PHAGE_Entero_2: P2 gpO-like protein; yfred0001_4170; phage(gi169936047) | 8e-59 | Click |
26 | 374170..375933 | PHAGE_Entero_2: P2 gpP-like protein; yfred0001_4180; phage(gi169936048) | 0.0 | Click |
27 | 376694..377686 | PHAGE_Entero_2: P2 gpQ-like protein; yfred0001_4200; phage(gi169936049) | 3e-133 | Click |
28 | 378548..379414 | hypothetical protein; yfred0001_4210 | 0.0 | Click |
29 | complement(379550..380302) | PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp21; yfred0001_4220; phage(gi119443673) | 2e-07 | Click |
30 | complement(380620..380877) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_4230; phage(gi422936662) | 2e-12 | Click |
31 | complement(380973..381131) | Hypothetical phage-related protein; yfred0001_4240 | 0.0 | Click |
32 | complement(381184..383592) | PHAGE_Entero_2: P2 gpA-like protein; yfred0001_4250; phage(gi169936054) | 1e-128 | Click |
33 | complement(383732..384556) | PHAGE_Entero_2: DNA adenine methylase-like protein; yfred0001_4260; phage(gi169936055) | 3e-74 | Click |
34 | complement(384564..384761) | PHAGE_Entero_2: hypothetical protein STM2732.Fels2; yfred0001_4270; phage(gi169936057) | 5e-06 | Click |
35 | complement(384844..385152) | hypothetical protein; yfred0001_4280 | 0.0 | Click |
36 | complement(385190..385321) | hypothetical protein; yfred0001_4290 | 0.0 | Click |
37 | complement(385327..385584) | hypothetical protein; yfred0001_4300 | 0.0 | Click |
38 | complement(385638..385844) | Hypothetical phage-related protein; yfred0001_4310 | 0.0 | Click |
39 | complement(385856..386059) | PHAGE_Vibrio_kappa: putative regulator; yfred0001_4320; phage(gi165970239) | 3e-07 | Click |
40 | complement(386072..386263) | PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0015; yfred0001_4330; phage(gi72537691) | 1e-08 | Click |
41 | 386324..386692 | PHAGE_Burkho_KS5: gp11; yfred0001_4340; phage(gi327198009) | 1e-12 | Click |
42 | 386829..387272 | hypothetical protein; yfred0001_4350 | 0.0 | Click |
43 | 387305..388108 | PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp21; yfred0001_4360; phage(gi119443673) | 1e-13 | Click |
44 | 387824..387835 | attR CGGAATTTTTCA | 0.0 | Click |
45 | 388133..389137 | PHAGE_Haemop_HP2: integrase; yfred0001_4370; phage(gi17981816) | 3e-100 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | 1269954..1269965 | attL TATTTATTGATT | 0.0 | Click |
2 | complement(1270441..1270584) | PHAGE_Entero_P4: integrase; yfred0001_25460; phage(gi9627511) | 9e-05 | Click |
3 | complement(1271619..1272494) | PHAGE_Entero_P1: Ban; yfred0001_25470; phage(gi46401697) | 1e-57 | Click |
4 | complement(1272620..1274953) | PHAGE_Entero_P4: DNA primase; yfred0001_25480; phage(gi9627512) | 0.0 | Click |
5 | complement(1274967..1275218) | PHAGE_Entero_P4: hypothetical protein P4p07; yfred0001_25490; phage(gi9627513) | 4e-11 | Click |
6 | complement(1275305..1275460) | hypothetical protein; yfred0001_25500 | 0.0 | Click |
7 | complement(1275565..1276107) | PHAGE_Entero_P4: putative CI repressor; yfred0001_25510; phage(gi9627516) | 1e-25 | Click |
8 | complement(1276112..1276300) | hypothetical protein; yfred0001_25520 | 0.0 | Click |
9 | complement(1276348..1276560) | PHAGE_Entero_P4: transcriptional regulator; yfred0001_25530; phage(gi9627517) | 8e-17 | Click |
10 | 1276559..1276681 | hypothetical protein; yfred0001_25540 | 0.0 | Click |
11 | 1277009..1277020 | attR TATTTATTGATT | 0.0 | Click |
12 | 1277206..1277907 | PHAGE_Entero_P4: head size determination protein sid; yfred0001_25550; phage(gi9627518) | 6e-18 | Click |
13 | 1277925..1278155 | PHAGE_Entero_PsP3: Pag; yfred0001_25560; phage(gi41057379) | 6e-12 | Click |
14 | complement(1278506..1279159) | hypothetical protein; yfred0001_25570 | 0.0 | Click |
15 | complement(1279177..1280205) | hypothetical protein; yfred0001_25580 | 0.0 | Click |
16 | complement(1280209..1281387) | PROPHAGE_Escher_CFT073: putative prophage integrase; yfred0001_25590; phage(gi26250313) | 3e-167 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | 1964726..1964776 | attL ACTCTTAATCAATTGGTCGCAGGTTCGAACCCTGCACGACCCACCAACAAA | 0.0 | Click |
2 | complement(1965228..1966388) | PHAGE_Entero_P2: gpD; yfred0001_8140; phage(gi9630355) | 2e-179 | Click |
3 | complement(1966880..1969324) | PHAGE_Entero_P2: gpT; yfred0001_8160; phage(gi9630353) | 0.0 | Click |
4 | complement(1969472..1969750) | PHAGE_Entero_P2: gpE; yfred0001_8170; phage(gi9630351) | 1e-35 | Click |
5 | complement(1969812..1970330) | PHAGE_Entero_P2: gpFII; yfred0001_8180; phage(gi9630350) | 1e-89 | Click |
6 | complement(1970343..1971533) | PHAGE_Entero_P2: gpFI; yfred0001_8190; phage(gi9630349) | 0.0 | Click |
7 | complement(1971663..1972241) | PHAGE_Entero_HK630: tail fiber assembly protein; yfred0001_8200; phage(gi428782810) | 2e-45 | Click |
8 | complement(1972244..1973476) | PHAGE_Erwini_ENT90: phage tail collar domain protein; yfred0001_8210; phage(gi431810938) | 2e-81 | Click |
9 | complement(1973529..1974110) | PHAGE_Entero_P2: gpI; yfred0001_8220; phage(gi9630345) | 3e-58 | Click |
10 | complement(1974127..1975035) | PHAGE_Entero_P2: gpJ; yfred0001_8230; phage(gi9630344) | 2e-131 | Click |
11 | complement(1975040..1975312) | PHAGE_Entero_P2: gpW; yfred0001_8240; phage(gi9630343) | 1e-35 | Click |
12 | complement(1975384..1976019) | PHAGE_Entero_P2: gpV; yfred0001_8250; phage(gi9630342) | 8e-96 | Click |
13 | 1976139..1976909 | PHAGE_Entero_P2: hypothetical protein P2p15; yfred0001_8260; phage(gi9630341) | 3e-11 | Click |
14 | complement(1976913..1977329) | PHAGE_Entero_P2: gpS; yfred0001_8270; phage(gi9630340) | 2e-33 | Click |
15 | complement(1977352..1977819) | PHAGE_Entero_P2: gpR; yfred0001_8280; phage(gi9630339) | 7e-71 | Click |
16 | complement(1977915..1978208) | PHAGE_Entero_P2: LysB; yfred0001_8290; phage(gi9630338) | 3e-34 | Click |
17 | complement(1978337..1978813) | PHAGE_Salmon_RE_2010: lysozyme; yfred0001_8300; phage(gi418489704) | 2e-53 | Click |
18 | complement(1978830..1979039) | PHAGE_Erwini_ENT90: hypothetical protein; yfred0001_8310; phage(gi431810988) | 7e-07 | Click |
19 | complement(1979245..1979751) | PHAGE_Entero_P2: gpL; yfred0001_8330; phage(gi9630333) | 4e-71 | Click |
20 | complement(1979841..1980479) | PHAGE_Entero_P2: gpM; yfred0001_8340; phage(gi9630332) | 2e-64 | Click |
21 | complement(1980507..1981574) | PHAGE_Entero_P2: gpN; yfred0001_8350; phage(gi9630331) | 9e-148 | Click |
22 | complement(1981596..1982417) | PHAGE_Entero_P2: gpO; yfred0001_8360; phage(gi9630330) | 4e-97 | Click |
23 | 1982560..1984323 | PHAGE_Entero_P2: gpP; yfred0001_8370; phage(gi9630329) | 0.0 | Click |
24 | complement(1985433..1986830) | RES domain family; yfred0001_8390 | 0.0 | Click |
25 | complement(1987016..1987912) | PHAGE_Clostr_st: hypothetical protein CST143; yfred0001_8400; phage(gi80159829) | 7e-07 | Click |
26 | complement(1987965..1989107) | PHAGE_Thermu_26: C5 cytosine-specific DNA methylase; yfred0001_8410; phage(gi157265426) | 4e-35 | Click |
27 | complement(1989318..1989548) | hypothetical protein; yfred0001_8420 | 0.0 | Click |
28 | complement(1990042..1992312) | PHAGE_Entero_P2: gpA; yfred0001_8430; phage(gi9630366) | 0.0 | Click |
29 | complement(1992539..1992784) | PHAGE_Entero_P2: hypothetical protein P2p36; yfred0001_8440; phage(gi9630362) | 8e-09 | Click |
30 | complement(1992858..1993313) | PHAGE_Entero_P2: gpB; yfred0001_8450; phage(gi9630361) | 5e-44 | Click |
31 | complement(1993364..1993540) | hypothetical protein; yfred0001_8460 | 0.0 | Click |
32 | 1993742..1994200 | Fels-2 prophage protein; yfred0001_8470 | 0.0 | Click |
33 | complement(1994201..1994722) | PHAGE_Aeromo_phiO18P: putative cII protein; yfred0001_8480; phage(gi148727135) | 8e-24 | Click |
34 | complement(1994750..1994929) | hypothetical protein; yfred0001_8490 | 0.0 | Click |
35 | 1995136..1995726 | PHAGE_Entero_PsP3: CI; yfred0001_8500; phage(gi41057393) | 1e-31 | Click |
36 | 1995734..1996738 | PHAGE_Erwini_ENT90: phage integrase family protein; yfred0001_8510; phage(gi431810942) | 2e-117 | Click |
37 | 1996804..1997583 | hypothetical protein; yfred0001_8520 | 0.0 | Click |
38 | 1997585..2000875 | PHAGE_Acanth_1: hypothetical protein ATCV1_Z596R; yfred0001_8530; phage(gi155371543) | 3e-12 | Click |
39 | 2001008..2001058 | attR ACTCTTAATCAATTGGTCGCAGGTTCGAACCCTGCACGACCCACCAACAAA | 0.0 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | complement(2192849..2193128) | PHAGE_Entero_SfV: hypothetical protein SfVp21; yfred0001_37820; phage(gi19548989) | 2e-07 | Click |
2 | complement(2193178..2193726) | PHAGE_Entero_SfV: tail protein; yfred0001_37830; phage(gi19548988) | 1e-16 | Click |
3 | complement(2193771..2194907) | PHAGE_Entero_SfV: tail protein; yfred0001_37840; phage(gi19549009) | 3e-32 | Click |
4 | complement(2194911..2195276) | PHAGE_Entero_SfV: tail protein; yfred0001_37850; phage(gi19549008) | 7e-13 | Click |
5 | complement(2195345..2195941) | PHAGE_Entero_SfV: tail protein; yfred0001_37860; phage(gi19549007) | 6e-16 | Click |
6 | complement(2195955..2196986) | PHAGE_Entero_SfV: tail protein; yfred0001_37870; phage(gi19549006) | 9e-33 | Click |
7 | complement(2197022..2198512) | PHAGE_Entero_SfV: tail/DNA circulation protein; yfred0001_37880; phage(gi19549005) | 3e-22 | Click |
8 | complement(2198513..2200108) | Methyl-accepting chemotaxis protein; yfred0001_37890 | 0.0 | Click |
9 | complement(2200229..2200528) | hypothetical protein; yfred0001_37900 | 0.0 | Click |
10 | complement(2200530..2200898) | PHAGE_Entero_SfV: hypothetical protein SfVp12; yfred0001_37910; phage(gi19549002) | 1e-09 | Click |
11 | complement(2200933..2202441) | PHAGE_Entero_SfV: tail sheath protein; yfred0001_37920; phage(gi19549001) | 8e-106 | Click |
12 | complement(2202637..2203167) | hypothetical protein; yfred0001_37930 | 0.0 | Click |
13 | complement(2203301..2203462) | hypothetical protein; yfred0001_37940 | 0.0 | Click |
14 | complement(2203497..2203814) | hypothetical protein; yfred0001_37950 | 0.0 | Click |
15 | complement(2203823..2204338) | PHAGE_Salmon_SE1: Gp19; yfred0001_37960; phage(gi219681236) | 6e-47 | Click |
16 | complement(2204340..2204618) | PHAGE_Salmon_SPN3UB: hypothetical protein; yfred0001_37970; phage(gi423262443) | 2e-17 | Click |
17 | complement(2204882..2205157) | PHAGE_Entero_cdtI: antitermination protein Q; yfred0001_37980; phage(gi148609434) | 3e-19 | Click |
18 | 2205635..2206357 | PHAGE_Entero_mEpX2: prophage repressor; yfred0001_37990; phage(gi428765656) | 3e-66 | Click |
19 | complement(2206435..2206566) | hypothetical protein; yfred0001_38000 | 0.0 | Click |
20 | 2206625..2206867 | PHAGE_Entero_mEp390: DinI-like family protein; yfred0001_38010; phage(gi428782688) | 9e-29 | Click |
21 | 2207190..2207465 | Methyl-accepting chemotaxis protein; yfred0001_38020 | 0.0 | Click |
22 | 2207558..2208976 | PHAGE_Celeri_P12053L: putative phage tail fiber protein; yfred0001_38030; phage(gi399528893) | 1e-09 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | complement(4394251..4395219) | PHAGE_Salmon_RE_2010: tail fiber protein; yfred0001_42890; phage(gi418489713) | 7e-11 | Click |
2 | complement(4395233..4395877) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42900; phage(gi422936704) | 2e-43 | Click |
3 | complement(4395983..4397068) | PHAGE_Pectob_ZF40: putative baseplate protein; yfred0001_42910; phage(gi422936703) | 1e-127 | Click |
4 | complement(4397491..4398168) | PHAGE_Pectob_ZF40: putative baseplate protein; yfred0001_42930; phage(gi422936701) | 9e-75 | Click |
5 | complement(4398176..4399024) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42940; phage(gi422936700) | 4e-74 | Click |
6 | complement(4399062..4399319) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42950; phage(gi422936699) | 3e-24 | Click |
7 | complement(4400020..4401681) | PHAGE_Pectob_ZF40: putative tail-fiber/lysozyme protein; yfred0001_42970; phage(gi422936697) | 3e-150 | Click |
8 | complement(4401812..4403350) | PHAGE_Entero_ES18: gp19; yfred0001_42980; phage(gi62362232) | 0.0 | Click |
9 | complement(4403601..4403990) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42990; phage(gi422936694) | 6e-39 | Click |
10 | complement(4403993..4404397) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43000; phage(gi422936693) | 1e-58 | Click |
11 | complement(4404404..4405504) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43010; phage(gi422936692) | 6e-160 | Click |
12 | complement(4405545..4406105) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43020; phage(gi422936691) | 7e-56 | Click |
13 | complement(4406527..4406988) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43040; phage(gi422936689) | 3e-65 | Click |
14 | complement(4406991..4407398) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43050; phage(gi422936688) | 9e-54 | Click |
15 | complement(4407423..4407803) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43060; phage(gi422936687) | 1e-16 | Click |
16 | complement(4407806..4408741) | PHAGE_Pectob_ZF40: putative major capsid protein; yfred0001_43070; phage(gi422936686) | 1e-146 | Click |
17 | complement(4409282..4410376) | PHAGE_Pectob_ZF40: putative head protein; yfred0001_43090; phage(gi422936684) | 2e-142 | Click |
18 | complement(4410493..4411242) | PHAGE_Pectob_ZF40: putative head protein; yfred0001_43100; phage(gi422936683) | 2e-109 | Click |
19 | complement(4411301..4412686) | PHAGE_Pectob_ZF40: putative portal protein; yfred0001_43110; phage(gi422936682) | 0.0 | Click |
20 | complement(4412689..4414332) | PHAGE_Pectob_ZF40: putative TerL large-subunit terminase; yfred0001_43120; phage(gi422936681) | 0.0 | Click |
21 | complement(4414462..4415421) | Transketolase; yfred0001_43130 | 0.0 | Click |
22 | complement(4415911..4416942) | PHAGE_Burkho_BcepMigl: terminase small subunit; yfred0001_43140; phage(gi431809885) | 4e-41 | Click |
23 | complement(4416946..4417206) | hypothetical protein; yfred0001_43150 | 0.0 | Click |
24 | complement(4417209..4417808) | PHAGE_Entero_phiEf11: conserved hypothetical protein; yfred0001_43160; phage(gi282598763) | 8e-68 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | complement(4559090..4560565) | PHAGE_Aggreg_S1249: hypothetical protein; yfred0001_43820; phage(gi273809558) | 2e-72 | Click |
2 | complement(4560570..4560953) | hypothetical protein; yfred0001_43830 | 0.0 | Click |
3 | complement(4561099..4561473) | hypothetical protein; yfred0001_43840 | 0.0 | Click |
4 | complement(4561484..4562035) | PHAGE_Psychr_pOW20_A: hypothetical protein; yfred0001_43850; phage(gi472339833) | 1e-09 | Click |
5 | complement(4562074..4562331) | hypothetical protein; yfred0001_43860 | 0.0 | Click |
6 | complement(4562432..4562776) | Disulfide bond chaperones of the HSP33 family; yfred0001_43870 | 0.0 | Click |
7 | complement(4562814..4563758) | PHAGE_Psychr_pOW20_A: hypothetical protein; yfred0001_43880; phage(gi472339830) | 1e-08 | Click |
8 | complement(4563771..4564241) | hypothetical protein; yfred0001_43890 | 0.0 | Click |
9 | complement(4564266..4565492) | PHAGE_Psychr_pOW20_A: hypothetical protein; yfred0001_43900; phage(gi472339828) | 3e-16 | Click |
10 | complement(4565496..4566089) | PHAGE_Psychr_pOW20_A: phage head morphogenesis protein; yfred0001_43910; phage(gi472339824) | 4e-14 | Click |
11 | complement(4566109..4567398) | PHAGE_Edward_MSW_3: putative portal protein; yfred0001_43920; phage(gi448261029) | 1e-35 | Click |
12 | complement(4567581..4569197) | PHAGE_Psychr_pOW20_A: phage terminase large subunit; yfred0001_43930; phage(gi472339822) | 8e-32 | Click |
13 | complement(4569427..4570128) | PHAGE_Burkho_BcepMigl: terminase small subunit; yfred0001_43940; phage(gi431809885) | 2e-44 | Click |
14 | complement(4570561..4570767) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_43950; phage(gi422936678) | 1e-06 | Click |
15 | complement(4571283..4571450) | hypothetical protein; yfred0001_43960 | 0.0 | Click |
16 | complement(4571608..4572138) | PHAGE_Pectob_ZF40: putative lysis protein; yfred0001_43970; phage(gi422936674) | 1e-73 | Click |
17 | 4572397..4572473 | tRNA | 0.0 | Click |
18 | 4572731..4573297 | PHAGE_Parame_FR483: hypothetical protein FR483_N177L; yfred0001_15630; phage(gi155370275) | 5e-06 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | complement(4638996..4639724) | PHAGE_Escher_D108: DNA modification protein Mom; yfred0001_12520; phage(gi281199700) | 8e-91 | Click |
2 | complement(4640008..4640490) | PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; yfred0001_12530; phage(gi399528832) | 6e-06 | Click |
3 | complement(4640660..4640797) | hypothetical protein; yfred0001_12540 | 0.0 | Click |
4 | complement(4640870..4641463) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_12550; phage(gi422936663) | 2e-62 | Click |
5 | complement(4641569..4641988) | hypothetical protein; yfred0001_12560 | 0.0 | Click |
6 | complement(4642017..4642208) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_12570; phage(gi422936662) | 3e-14 | Click |
7 | complement(4642363..4643004) | PHAGE_Pseudo_F116: DNA adenine methyltransferase; yfred0001_12580; phage(gi56692911) | 5e-37 | Click |
8 | 4642885..4642896 | attL GCGGGCCTGTTC | 0.0 | Click |
9 | complement(4643199..4645337) | PHAGE_Pectob_ZF40: putative methylase; yfred0001_12590; phage(gi422936661) | 0.0 | Click |
10 | complement(4645391..4645897) | PHAGE_Klebsi_JD001: hypothetical protein; yfred0001_12600; phage(gi448245144) | 5e-07 | Click |
11 | complement(4646575..4647933) | PHAGE_Salmon_vB_SemP_Emek: DnaB helicase; yfred0001_12610; phage(gi399498841) | 1e-112 | Click |
12 | complement(4647945..4648985) | PHAGE_Staphy_P954: hypothetical protein; yfred0001_12620; phage(gi257136376) | 2e-28 | Click |
13 | complement(4648988..4649212) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_12630; phage(gi422936653) | 2e-25 | Click |
14 | complement(4649229..4649693) | PHAGE_Pectob_ZF40: putative cII repressor; yfred0001_12640; phage(gi422936652) | 8e-37 | Click |
15 | complement(4649754..4649888) | PHAGE_Pectob_ZF40: putative cro anti-repressor; yfred0001_12650; phage(gi422936651) | 2e-14 | Click |
16 | 4649989..4650693 | PHAGE_Pectob_ZF40: putative cI repressor; yfred0001_12660; phage(gi422936650) | 5e-95 | Click |
17 | 4650875..4651027 | hypothetical protein; yfred0001_12670 | 0.0 | Click |
18 | 4651398..4651676 | hypothetical protein; yfred0001_12680 | 0.0 | Click |
19 | 4651732..4653930 | PHAGE_Pectob_ZF40: putative exonuclease; yfred0001_12690; phage(gi422936647) | 2e-179 | Click |
20 | 4654011..4654427 | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_12700; phage(gi422936646) | 2e-56 | Click |
21 | 4654642..4654797 | hypothetical protein; yfred0001_12710 | 0.0 | Click |
22 | 4654868..4655074 | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_12720; phage(gi422936644) | 3e-12 | Click |
23 | 4654975..4654986 | attR GCGGGCCTGTTC | 0.0 | Click |
24 | 4655264..4656274 | PHAGE_Pectob_ZF40: putative integrase; yfred0001_12730; phage(gi422936642) | 4e-120 | Click |
25 | complement(4656339..4657842) | Virulence factor; yfred0001_3390 | 0.0 | Click |
26 | complement(4657847..4659190) | PHAGE_Macaci_1: large tegument protein; yfred0001_3400; phage(gi30984464) | 5e-06 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | 4706512..4706523 | attL AATGTAAAAAAT | 0.0 | Click |
2 | complement(4706685..4708322) | PHAGE_Thalas_BA3: hypothetical protein BA3_0002; yfred0001_44220; phage(gi160700596) | 6e-43 | Click |
3 | complement(4708407..4708982) | PHAGE_Escher_HK639: rha protein; yfred0001_44230; phage(gi356870673) | 6e-52 | Click |
4 | complement(4709526..4709681) | hypothetical protein; yfred0001_44240 | 0.0 | Click |
5 | complement(4709714..4709899) | hypothetical protein; yfred0001_44250 | 0.0 | Click |
6 | complement(4710110..4711486) | PHAGE_Escher_TL_2011c: hypothetical protein; yfred0001_44260; phage(gi418487119) | 2e-41 | Click |
7 | complement(4711759..4712142) | PHAGE_Escher_TL_2011c: hypothetical protein; yfred0001_44280; phage(gi418487117) | 1e-33 | Click |
8 | complement(4712158..4712475) | PHAGE_Escher_TL_2011c: hypothetical protein; yfred0001_44290; phage(gi418487116) | 2e-22 | Click |
9 | 4712553..4712728 | Integrase; yfred0001_44300 | 0.0 | Click |
10 | complement(4712729..4716108) | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; yfred0001_31340; phage(gi414087138) | 4e-38 | Click |
11 | complement(4716315..4716509) | hypothetical protein; yfred0001_31350 | 0.0 | Click |
12 | complement(4716565..4716678) | hypothetical protein; yfred0001_31360 | 0.0 | Click |
13 | 4717006..4717461 | Acetyltransferase; yfred0001_31370 | 0.0 | Click |
14 | complement(4717493..4718020) | Isochorismatase family protein; yfred0001_31380 | 0.0 | Click |
15 | complement(4718078..4718656) | hypothetical protein; yfred0001_31390 | 0.0 | Click |
16 | complement(4718855..4720327) | PHAGE_Burkho_phi1026b: gp59; yfred0001_31400; phage(gi38707949) | 4e-62 | Click |
17 | 4729791..4729802 | attR AATGTAAAAAAT | 0.0 | Click |
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|
1 | 4716976..4716987 | attL TTCCCACTCATC | 0.0 | Click |
2 | complement(4726182..4726337) | Phage integrase family protein; yfred0001_720 | 0.0 | Click |
3 | complement(4726869..4727627) | PHAGE_Mycoba_Bxz2: gp61; yfred0001_730; phage(gi29566080) | 4e-08 | Click |
4 | 4728462..4728473 | attL AACATGTTAAAT | 0.0 | Click |
5 | 4728964..4729125 | PHAGE_Entero_HK620: integrase; yfred0001_740; phage(gi13559824) | 9e-11 | Click |
6 | 4730129..4731769 | Hemolysin activator protein; yfred0001_750 | 0.0 | Click |
7 | 4731804..4737896 | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; yfred0001_760; phage(gi414087138) | 9e-29 | Click |
8 | 4737910..4738035 | hypothetical protein; yfred0001_42670 | 0.0 | Click |
9 | complement(4739162..4739560) | PHAGE_Entero_mEp390: late gene regulator Q; yfred0001_42680; phage(gi428782710) | 3e-35 | Click |
10 | complement(4739850..4740443) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42690; phage(gi422936663) | 3e-62 | Click |
11 | complement(4740997..4741245) | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42700; phage(gi422936656) | 6e-18 | Click |
12 | complement(4741521..4741928) | PHAGE_Escher_HK639: replication protein 14; yfred0001_42710; phage(gi356870655) | 2e-20 | Click |
13 | complement(4741993..4742988) | PHAGE_Escher_TL_2011b: hypothetical protein; yfred0001_42720; phage(gi418487646) | 4e-44 | Click |
14 | complement(4743447..4743887) | PHAGE_Pectob_ZF40: putative cII repressor; yfred0001_42730; phage(gi422936652) | 1e-35 | Click |
15 | complement(4743928..4744188) | PHAGE_Gifsy_2: putative bacteriophage regulatory protein; Lambda gpCro analog; yfred0001_42740; phage(gi169257277) | 1e-05 | Click |
16 | 4744933..4745151 | PHAGE_Escher_D108: hypothetical protein; yfred0001_42750; phage(gi281199650) | 4e-06 | Click |
17 | 4745360..4745692 | hypothetical protein; yfred0001_42760 | 0.0 | Click |
18 | 4745741..4745935 | hypothetical protein; yfred0001_42770 | 0.0 | Click |
19 | 4745944..4746216 | hypothetical protein; yfred0001_42780 | 0.0 | Click |
20 | 4746272..4748377 | PHAGE_Pectob_ZF40: putative exonuclease; yfred0001_42790; phage(gi422936647) | 2e-114 | Click |
21 | 4748425..4748886 | PHAGE_Pectob_ZF40: hypothetical protein; yfred0001_42800; phage(gi422936646) | 2e-32 | Click |
22 | 4749200..4750175 | PHAGE_Entero_mEp235: integrase; yfred0001_42810; phage(gi428781836) | 2e-62 | Click |
23 | 4750193..4750204 | attR AACATGTTAAAT | 0.0 | Click |
24 | 4755492..4755503 | attR TTCCCACTCATC | 0.0 | Click |