Yersinia mollaretii ATCC 43969 , whole genome shotgun [asmbl_id: NC_000000].4549461, GC%: 49.02%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1590667..1592454) PHAGE_Celeri_P12053L: putative phage tail fiber protein; ymoll0001_26240; phage(gi399528893) 4e-10 Click
2complement(1592884..1593126) PHAGE_Entero_mEp390: DinI-like family protein; ymoll0001_26250; phage(gi428782688) 3e-26 Click
3complement(1593375..1594097) PHAGE_Cronob_ENT39118: phage repressor protein; ymoll0001_26260; phage(gi431811060) 3e-65 Click
41594401..1594841 PHAGE_Entero_mEp390: late gene regulator Q; ymoll0001_26270; phage(gi428782710) 1e-40 Click
51595094..1595372 PHAGE_Salmon_SPN3UB: hypothetical protein; ymoll0001_26280; phage(gi423262443) 1e-18 Click
61595398..1595874 PHAGE_Salmon_SE1: Gp19; ymoll0001_26290; phage(gi219681236) 2e-43 Click
71595890..1596510 hypothetical protein; ymoll0001_26300 0.0 Click
81596706..1598214 PHAGE_Entero_SfV: tail sheath protein; ymoll0001_26310; phage(gi19549001) 4e-105 Click
91598333..1598701 PHAGE_Entero_SfV: hypothetical protein SfVp12; ymoll0001_26320; phage(gi19549002) 1e-09 Click
101598703..1599002 hypothetical protein; ymoll0001_26330 0.0 Click
111599123..1600481 Methyl-accepting chemotaxis protein; ymoll0001_26340 0.0 Click
121600572..1601978 PHAGE_Entero_SfV: tail/DNA circulation protein; ymoll0001_26350; phage(gi19549005) 2e-23 Click
131602053..1603045 PHAGE_Entero_SfV: tail protein; ymoll0001_26360; phage(gi19549006) 2e-30 Click
141603061..1603657 PHAGE_Entero_SfV: tail protein; ymoll0001_26370; phage(gi19549007) 6e-16 Click
151603783..1604091 PHAGE_Entero_SfV: tail protein; ymoll0001_26380; phage(gi19549008) 3e-10 Click
161604095..1605231 PHAGE_Entero_SfV: tail protein; ymoll0001_26390; phage(gi19549009) 9e-34 Click
171605276..1605824 PHAGE_Entero_SfV: tail protein; ymoll0001_26400; phage(gi19548988) 5e-16 Click
181605904..1606839 PHAGE_Klebsi_JD001: putative tail-fiber protein; ymoll0001_26410; phage(gi448245166) 6e-10 Click
19complement(1606876..1607013) hypothetical protein; ymoll0001_26420 0.0 Click
201607230..1607961 PHAGE_Acanth_moumouvirus: putative glucosamine-fructose-6-phosphate aminotransferase; ymoll0001_26430; phage(gi441432573) 4e-05 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11887947..1887959 attL    GAGGATGAAAACA 0.0 Click
2complement(1896408..1898741) PHAGE_Entero_P4: DNA primase; ymoll0001_2480; phage(gi9627512) 0.0 Click
3complement(1898755..1899096) PHAGE_Entero_P4: hypothetical protein P4p07; ymoll0001_2490; phage(gi9627513) 4e-16 Click
4complement(1899353..1899682) PHAGE_Entero_P4: putative CI repressor; ymoll0001_2500; phage(gi9627516) 2e-29 Click
5complement(1899903..1900091) hypothetical protein; ymoll0001_2510 0.0 Click
6complement(1900139..1900396) PHAGE_Entero_P4: transcriptional regulator; ymoll0001_2520; phage(gi9627517) 4e-17 Click
71900998..1901699 PHAGE_Entero_P4: head size determination protein sid; ymoll0001_2530; phage(gi9627518) 4e-17 Click
81901834..1901947 hypothetical protein; ymoll0001_2540 0.0 Click
9complement(1902707..1903522) PHAGE_Salmon_SSU5: hypothetical protein; ymoll0001_2550; phage(gi410491447) 2e-12 Click
10complement(1903539..1904714) PROPHAGE_Escher_CFT073: putative prophage integrase; ymoll0001_2560; phage(gi26250313) 1e-165 Click
111919210..1919222 attR    GAGGATGAAAACA 0.0 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13059934..3060013 attL    CTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA 0.0 Click
2complement(3063160..3063354) PHAGE_Salmon_RE_2010: integrase; ymoll0001_17540; phage(gi418489683) 7e-10 Click
3complement(3063653..3064534) PHAGE_Vibrio_kappa: putative NAD-dependent DNA ligase; ymoll0001_17550; phage(gi165970237) 1e-33 Click
4complement(3064577..3065146) PHAGE_Entero_PsP3: CI; ymoll0001_17560; phage(gi41057393) 2e-26 Click
53065322..3065456 PHAGE_Pasteu_F108: Cox; ymoll0001_17570; phage(gi109302900) 7e-05 Click
63065511..3066020 PHAGE_Salmon_RE_2010: regulatory protein; ymoll0001_17580; phage(gi418489686) 6e-50 Click
73066227..3066538 GpB bacteriophage P2-like protein; ymoll0001_17590 0.0 Click
83066661..3066852 PHAGE_Salmon_RE_2010: hypothetical protein; ymoll0001_17600; phage(gi418489689) 1e-07 Click
93066857..3067801 PHAGE_Yersin_413C: gpA; ymoll0001_17610; phage(gi30065742) 6e-36 Click
103067805..3068464 PHAGE_Yersin_413C: gpM; ymoll0001_17620; phage(gi30065709) 2e-59 Click
113068564..3069037 PHAGE_Yersin_413C: gpL; ymoll0001_17630; phage(gi30065710) 3e-44 Click
123069243..3069452 PHAGE_Erwini_ENT90: hypothetical protein; ymoll0001_17650; phage(gi431810988) 2e-08 Click
133069493..3069942 PHAGE_Entero_2: endolysin; ymoll0001_17660; phage(gi169936041) 3e-50 Click
143069944..3070360 PHAGE_Yersin_413C: LysB; ymoll0001_17670; phage(gi30065715) 4e-13 Click
153070456..3070911 PHAGE_Yersin_413C: gpR; ymoll0001_17680; phage(gi30065716) 1e-40 Click
163070917..3071363 PHAGE_Yersin_413C: gpS; ymoll0001_17690; phage(gi30065717) 5e-32 Click
173071446..3072930 hypothetical protein; ymoll0001_17700 0.0 Click
183073015..3073686 PHAGE_Yersin_413C: gpV; ymoll0001_17710; phage(gi30065718) 4e-68 Click
193073707..3074033 PHAGE_Yersin_413C: gpW; ymoll0001_17720; phage(gi30065719) 2e-34 Click
203074038..3074946 PHAGE_Yersin_413C: gpJ; ymoll0001_17730; phage(gi30065720) 3e-117 Click
213074972..3075547 PROPHAGE_Salmon_Ty2: putative phage tail protein; ymoll0001_17740; phage(gi29143753) 4e-70 Click
223075637..3076695 PHAGE_Yersin_413C: gpH; ymoll0001_17750; phage(gi30065722) 3e-51 Click
23complement(3076909..3077367) PHAGE_Bacter_2: tail fiber; ymoll0001_17770; phage(gi212499733) 1e-16 Click
24complement(3077765..3077917) hypothetical protein; ymoll0001_17780 0.0 Click
253078478..3079044 PHAGE_Entero_2: DNA-invertase; ymoll0001_17790; phage(gi169936026) 1e-70 Click
263079217..3080386 PHAGE_Yersin_413C: gpFI; ymoll0001_17800; phage(gi30065725) 3e-170 Click
273080400..3080915 PHAGE_Yersin_413C: FII; ymoll0001_17810; phage(gi30065726) 2e-62 Click
283080958..3081281 PHAGE_Yersin_413C: gpE; ymoll0001_17820; phage(gi30065727) 1e-24 Click
293081314..3081436 PHAGE_Yersin_413C: gpE+E'; ymoll0001_17830; phage(gi30065728) 5e-11 Click
303081456..3083840 PHAGE_Yersin_413C: gpT; ymoll0001_17840; phage(gi30065729) 0.0 Click
313084328..3085494 PHAGE_Yersin_413C: gpD; ymoll0001_17860; phage(gi30065731) 1e-144 Click
323086025..3086104 attR    CTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA 0.0 Click

Region 4, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13351978..3351989 attL    CCAACCCGTTGC 0.0 Click
2complement(3360283..3361329) PHAGE_Entero_WV8: putative head maturation protease; ymoll0001_19560; phage(gi238801794) 4e-14 Click
33361501..3362262 PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; ymoll0001_19570; phage(gi116326757) 1e-07 Click
43362275..3362865 PHAGE_Cyanop_PSS2: BtuR/CobO ATP:corrinoid adenosyltransferase; ymoll0001_19580; phage(gi254729498) 1e-14 Click
5complement(3363002..3364030) Ribosomal large subunit pseudouridine synthase B; ymoll0001_19590 0.0 Click
63364142..3365821 PHAGE_Pelagi_HTVC019P: integrase; ymoll0001_19600; phage(gi460042383) 6e-08 Click
73366424..3366624 hypothetical protein; ymoll0001_19610 0.0 Click
8complement(3366724..3368145) PHAGE_Acanth_moumouvirus: UvrD/REP helicase family protein; ymoll0001_19620; phage(gi441432531) 6e-06 Click
9complement(3368156..3369883) PHAGE_Burkho_KS5: gp28; ymoll0001_19630; phage(gi327198026) 7e-05 Click
10complement(3370437..3370571) hypothetical protein; ymoll0001_19640 0.0 Click
113370734..3370746 attL    ACTCTGATGCAAC 0.0 Click
123371548..3372576 hypothetical protein; ymoll0001_19650 0.0 Click
133373177..3373458 PHAGE_Sodali_phiSG1: resolvase; ymoll0001_19660; phage(gi89886020) 6e-07 Click
143382918..3382930 attR    ACTCTGATGCAAC 0.0 Click
153388126..3388137 attR    CCAACCCGTTGC 0.0 Click