Pseudomonas aeruginosa 2192 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].6826253, GC%: 66.18%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1827070..827149 attL    GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGGCTCCTGGTGTCGTGGGTTCGATTCCCATCGTCCACCCCATATT 0.0 Click
2827448..828683 PHAGE_Pseudo_F116: integrase; PP_00824; phage(gi56692927) 0.0 Click
3complement(828684..828917) PHAGE_Pseudo_phi297: putative AlpA family transcriptional regulator; PP_00825; phage(gi374531313) 3e-38 Click
4829188..829421 hypothetical protein PFLU2848 [Pseudomonas fluorescens SBW25] gi|229590308|ref|YP_002872427.1|; PP_00826 6e-06 Click
5complement(829431..829553) hypothetical protein NCGM2_3888 [Pseudomonas aeruginosa NCGM2.S1] gi|386066810|ref|YP_005982114.1|; PP_00827 5e-13 Click
6complement(829546..830502) PHAGE_Pseudo_phi297: hypothetical protein; PP_00828; phage(gi374531246) 3e-93 Click
7complement(830502..831224) PHAGE_Pseudo_F116: hypothetical protein F116p03; PP_00829; phage(gi56692930) 1e-25 Click
8complement(831274..831780) hypothetical protein PSPA7_2369 [Pseudomonas aeruginosa PA7] gi|152988337|ref|YP_001347736.1|; PP_00830 2e-88 Click
9complement(831975..832349) PHAGE_Pseudo_F116: hypothetical protein F116p05; PP_00831; phage(gi56692932) 2e-69 Click
10complement(834589..836361) PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp44; PP_00832; phage(gi17313261) 0.0 Click
11complement(836731..836949) hypothetical protein PLES_15711 [Pseudomonas aeruginosa LESB58] gi|218890311|ref|YP_002439175.1|; PP_00833 4e-27 Click
12complement(838224..838718) PHAGE_Pseudo_F116: LexA-like protein; PP_00834; phage(gi56692912) 1e-06 Click
13complement(838745..839071) PHAGE_Pseudo_F116: single-stranded DNA-binding protein; PP_00835; phage(gi56692915) 1e-57 Click
14complement(839247..839852) PHAGE_Pseudo_F116: exonuclease; PP_00836; phage(gi56692916) 6e-114 Click
15complement(839974..840972) PHAGE_Pseudo_F116: hypothetical protein F116p18; PP_00837; phage(gi56692937) 2e-32 Click
16841428..841631 hypothetical; PP_00838 0.0 Click
17complement(841683..841919) PHAGE_Pseudo_F116: hypothetical protein F116p22; PP_00839; phage(gi56692941) 1e-13 Click
18complement(842687..843058) PHAGE_Pseudo_F116: regulatory protein; PP_00840; phage(gi56692917) 7e-43 Click
19complement(843093..843305) PHAGE_Pseudo_F116: hypothetical protein F116p25; PP_00841; phage(gi56692943) 5e-34 Click
20complement(843370..843546) PHAGE_Pseudo_F116: hypothetical protein F116p26; PP_00842; phage(gi56692944) 3e-29 Click
21complement(843626..843799) PHAGE_Pseudo_F116: hypothetical protein F116p27; PP_00843; phage(gi56692945) 1e-26 Click
22844211..844477 PHAGE_Pseudo_F116: hypothetical protein F116p28; PP_00844; phage(gi56692946) 1e-45 Click
23complement(844514..845317) PHAGE_Pseudo_F116: transcriptional regulator; PP_00845; phage(gi56692918) 1e-150 Click
24845621..846622 PHAGE_Pseudo_F116: hypothetical protein F116p32; PP_00846; phage(gi56692948) 9e-91 Click
25846609..847466 PHAGE_Pseudo_F116: hypothetical protein F116p33; PP_00847; phage(gi56692949) 2e-153 Click
26847459..848010 PHAGE_Pseudo_F116: hypothetical protein F116p34; PP_00848; phage(gi56692950) 5e-102 Click
27848177..848680 PHAGE_Pseudo_PAJU2: putative NinG; PP_00849; phage(gi209552490) 2e-48 Click
28848759..849253 PHAGE_Pseudo_F116: hypothetical protein F116p37; PP_00850; phage(gi56692953) 1e-78 Click
29849846..850199 PHAGE_Entero_Sf6: gene 1 protein; PP_00851; phage(gi41057279) 4e-19 Click
30850196..851224 PHAGE_Entero_Sf6: gene 2 protein; PP_00852; phage(gi41057280) 5e-50 Click
31851185..851481 PHAGE_Pelagi_HTVC010P: phage terminase large subunit; PP_00853; phage(gi460042259) 1e-06 Click
32851491..853812 PHAGE_Pseudo_F116: portal protein; PP_00854; phage(gi56692922) 0.0 Click
33854976..856268 PHAGE_Pseudo_F116: virion structural protein; PP_00855; phage(gi56692923) 0.0 Click
34856327..856806 PHAGE_Pseudo_F116: virion structural protein; PP_00856; phage(gi56692924) 2e-83 Click
35856871..857743 PHAGE_Pseudo_F116: hypothetical protein F116p45; PP_00857; phage(gi56692956) 3e-166 Click
36857740..858417 PHAGE_Pseudo_F116: hypothetical protein F116p46; PP_00858; phage(gi56692957) 4e-130 Click
37858414..858620 PHAGE_Pseudo_F116: hypothetical protein F116p47; PP_00859; phage(gi56692958) 9e-32 Click
38858601..859008 PHAGE_Pseudo_F116: hypothetical protein F116p48; PP_00860; phage(gi56692959) 5e-73 Click
39859034..859429 hypothetical; PP_00861 0.0 Click
40859413..859748 PHAGE_Pseudo_F116: hypothetical protein F116p49; PP_00862; phage(gi56692960) 3e-52 Click
41859748..860605 PHAGE_Pseudo_F116: hypothetical protein F116p50; PP_00863; phage(gi56692961) 1e-160 Click
42860608..863571 PHAGE_Pseudo_F116: hypothetical protein F116p51; PP_00864; phage(gi56692962) 0.0 Click
43863571..864761 PHAGE_Pseudo_F116: hypothetical protein F116p52; PP_00865; phage(gi56692963) 0.0 Click
44864829..865419 PHAGE_Pseudo_F116: hypothetical protein F116p53; PP_00866; phage(gi56692964) 2e-106 Click
45865424..868021 PHAGE_Pseudo_F116: hypothetical protein F116p54; PP_00867; phage(gi56692965) 0.0 Click
46868014..869177 PHAGE_Pseudo_F116: hypothetical protein F116p56; PP_00868; phage(gi56692967) 2e-111 Click
47869177..871069 PHAGE_Pseudo_F116: hypothetical protein F116p57; PP_00869; phage(gi56692968) 1e-154 Click
48871211..873238 PHAGE_Pseudo_F116: hypothetical protein F116p58; PP_00870; phage(gi56692969) 0.0 Click
49complement(873526..874161) hypothetical; PP_00871 0.0 Click
50874438..884565 PHAGE_Pseudo_F116: hypothetical protein F116p59; PP_00872; phage(gi56692970) 0.0 Click
51884678..884917 PHAGE_Pseudo_F116: holin; PP_00873; phage(gi56692925) 9e-37 Click
52884922..885428 PHAGE_Pseudo_F116: lysozyme; PP_00874; phage(gi56692926) 6e-95 Click
53885432..885953 PHAGE_Pseudo_F116: hypothetical protein F116p63; PP_00875; phage(gi56692972) 2e-63 Click
54885964..886557 PHAGE_Pseudo_F116: hypothetical protein F116p64; PP_00876; phage(gi56692973) 3e-98 Click
55888073..888152 attR    GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGGCTCCTGGTGTCGTGGGTTCGATTCCCATCGTCCACCCCATATT 0.0 Click

Region 2, total : 54 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1089517..1091289) PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp44; PP_01071; phage(gi17313261) 0.0 Click
2complement(1091286..1092086) PHAGE_Mycoba_Llij: gp66; PP_01072; phage(gi109392252) 2e-09 Click
3complement(1093238..1093474) PHAGE_Pseudo_phi297: putative DNA segregation ATPase; PP_01073; phage(gi374531256) 8e-12 Click
4complement(1093524..1094174) PHAGE_Pseudo_phi297: putative recombinase; PP_01074; phage(gi374531255) 1e-100 Click
5complement(1094178..1095149) PHAGE_Pseudo_phi297: putative DNA segregation ATPase; PP_01075; phage(gi374531256) 3e-172 Click
6complement(1095162..1095362) PHAGE_Pseudo_phi297: hypothetical protein; PP_01076; phage(gi374531257) 5e-32 Click
7complement(1095369..1096364) PHAGE_Pseudo_phi297: putative RecT protein; PP_01077; phage(gi374531258) 6e-53 Click
8complement(1096361..1096576) hypothetical; PP_01078 0.0 Click
9complement(1096585..1097388) PHAGE_Pseudo_phi297: hypothetical protein; PP_01079; phage(gi374531259) 1e-149 Click
10complement(1097396..1097533) PHAGE_Pseudo_phi297: hypothetical protein; PP_01080; phage(gi374531260) 3e-18 Click
11complement(1097850..1098029) PHAGE_Pseudo_phi297: hypothetical protein; PP_01081; phage(gi374531261) 1e-26 Click
12complement(1098026..1098217) PHAGE_Pseudo_phi297: hypothetical protein; PP_01083; phage(gi374531262) 6e-15 Click
13complement(1098231..1098383) PHAGE_Pseudo_phi297: hypothetical protein; PP_01082; phage(gi374531263) 4e-19 Click
14complement(1098960..1099331) PHAGE_Pseudo_phi297: global regulatory protein; PP_01084; phage(gi374531265) 4e-64 Click
15complement(1099362..1099625) PHAGE_Pseudo_phi297: hypothetical protein; PP_01085; phage(gi374531266) 1e-45 Click
16complement(1100141..1100947) hypothetical; PP_01086 0.0 Click
17complement(1100977..1101345) PHAGE_Pseudo_F116: transcriptional regulator; PP_01088; phage(gi56692918) 3e-34 Click
181101814..1102035 hypothetical protein T1E_1339 [Pseudomonas putida DOT-T1E] gi|397694105|ref|YP_006531986.1|; PP_01087 6e-12 Click
191102130..1102726 hypothetical protein PFLU2851 [Pseudomonas fluorescens SBW25] gi|229590311|ref|YP_002872430.1|; PP_01089 5e-37 Click
201103523..1104284 PHAGE_Pseudo_PAJU2: putative replication protein P; PP_01090; phage(gi209552483) 5e-05 Click
211104370..1104720 PHAGE_Pseudo_phi297: holliday junction resolvase; PP_01091; phage(gi374531280) 8e-33 Click
221104749..1105435 PHAGE_Pseudo_phi297: hypothetical protein; PP_01092; phage(gi374531281) 2e-132 Click
231105550..1105939 PHAGE_Pseudo_phi297: hypothetical protein; PP_01093; phage(gi374531282) 2e-68 Click
241106070..1106216 PHAGE_Pseudo_phi297: hypothetical protein; PP_01094; phage(gi374531283) 1e-18 Click
251106225..1106824 PHAGE_Pseudo_phi297: terminase small subunit; PP_01095; phage(gi374531284) 8e-55 Click
261106793..1108094 PHAGE_Pseudo_H105/1: phage terminase large subunit; PP_01096; phage(gi327198525) 3e-104 Click
271108094..1109902 PHAGE_Iodoba_phiPLPE: gp19 putative portal protein; PP_01097; phage(gi197085633) 2e-60 Click
281109905..1111026 PHAGE_Iodoba_phiPLPE: gp27 putative head protein; PP_01098; phage(gi197085641) 1e-37 Click
291111366..1111482 hypothetical; PP_01099 0.0 Click
301111492..1112421 PHAGE_Synech_S_CBS4: major capsid protein; PP_01100; phage(gi374531766) 1e-35 Click
311112434..1112877 hypothetical; PP_01101 0.0 Click
321112936..1113061 hypothetical; PP_01102 0.0 Click
331113054..1113575 PHAGE_Salico_CGphi29: hypothetical protein; PP_01103; phage(gi472340176) 2e-25 Click
341113572..1114564 PHAGE_Roseob_1: head morphogenesis protein; PP_01104; phage(gi331028124) 2e-17 Click
351114557..1114943 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01105; phage(gi423262010) 1e-10 Click
361115015..1115338 PHAGE_Entero_TLS: gp40; PP_01106; phage(gi148734512) 4e-14 Click
371115298..1115741 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01107; phage(gi423262013) 6e-13 Click
381115803..1116972 PHAGE_Pseudo_phi297: hypothetical protein; PP_01108; phage(gi374531298) 9e-14 Click
391117031..1117519 hypothetical protein PPS_2485 [Pseudomonas putida S16] gi|339487396|ref|YP_004701924.1|; PP_01109 1e-34 Click
401117639..1117914 hypothetical protein B479_10405 [Pseudomonas putida HB3267] gi|431802023|ref|YP_007228926.1|; PP_01110 1e-10 Click
411117865..1121023 PHAGE_Pseudo_MP29: putative tail component protein; PP_01111; phage(gi215480016) 2e-89 Click
421121112..1121351 PHAGE_Escher_HK75: minor tail protein; PP_01112; phage(gi356870692) 3e-14 Click
431121348..1122094 PHAGE_Entero_mEp237: minor tail protein L; PP_01113; phage(gi435439282) 5e-75 Click
441122097..1122855 PHAGE_Entero_HK446: minor tail protein K; PP_01114; phage(gi428782210) 6e-62 Click
451123451..1123909 PHAGE_Entero_mEpX2: tail assembly protein; PP_01115; phage(gi428765633) 7e-40 Click
461124371..1128144 PHAGE_Entero_mEpX1: central tail fiber J; PP_01116; phage(gi428781892) 0.0 Click
471128141..1128425 hypothetical protein PSPA7_2427 [Pseudomonas aeruginosa PA7] gi|152985757|ref|YP_001347794.1|; PP_01117 4e-47 Click
481129247..1129900 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp025; PP_01118; phage(gi148912790) 1e-29 Click
491130144..1130287 hypothetical; PP_01119 0.0 Click
501130388..1130903 PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PP_01120; phage(gi148912826) 9e-49 Click
511130873..1131226 PHAGE_Rhodob_RcapMu: hypothetical protein; PP_01121; phage(gi356870872) 1e-22 Click
521131397..1131597 PHAGE_Pseudo_phi297: hypothetical protein; PP_01122; phage(gi374531309) 3e-23 Click
531131594..1131923 PHAGE_Pseudo_phi297: hypothetical protein; PP_01123; phage(gi374531310) 3e-48 Click
541131959..1132222 PHAGE_Pseudo_phi297: hypothetical protein; PP_01124; phage(gi374531311) 6e-47 Click

Region 3, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13252848..3255835 PROPHAGE_Xylell_Temecula1: serine protease; PP_03158; phage(gi77747673) 1e-41 Click
2complement(3256229..3256660) hypothetical protein PA3536 [Pseudomonas aeruginosa PAO1] gi|15598732|ref|NP_252226.1|; PP_03159 4e-72 Click
3complement(3256997..3257263) PHAGE_Pseudo_F116: hypothetical protein F116p66; PP_03160; phage(gi56692975) 4e-44 Click
43257570..3257872 hypothetical; PP_03161 0.0 Click
5complement(3258068..3258325) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp027; PP_03162; phage(gi148912792) 5e-35 Click
6complement(3258322..3258624) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp026; PP_03163; phage(gi148912791) 9e-45 Click
7complement(3259573..3259806) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp024; PP_03164; phage(gi148912789) 1e-37 Click
8complement(3259854..3260390) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp023; PP_03165; phage(gi148912788) 1e-94 Click
9complement(3260419..3260610) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp022; PP_03166; phage(gi148912787) 2e-30 Click
10complement(3260603..3261190) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp021; PP_03167; phage(gi148912786) 1e-105 Click
11complement(3261220..3262878) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp020; PP_03168; phage(gi148912785) 0.0 Click
12complement(3262875..3263279) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp019; PP_03169; phage(gi148912784) 6e-70 Click
13complement(3263290..3263442) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp018; PP_03170; phage(gi148912783) 5e-21 Click
14complement(3263835..3264245) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp017; PP_03171; phage(gi148912782) 1e-67 Click
15complement(3264248..3265945) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp016; PP_03172; phage(gi148912781) 0.0 Click
16complement(3265945..3266082) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp015; PP_03173; phage(gi148912780) 3e-21 Click
17complement(3266506..3268989) PHAGE_Pseudo_F10: Putative tail length tape measure protein; PP_03174; phage(gi148912778) 0.0 Click
18complement(3270172..3270924) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; PP_03175; phage(gi148912775) 1e-128 Click
19complement(3270926..3271120) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp009; PP_03176; phage(gi148912774) 1e-29 Click
20complement(3271591..3271845) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp007; PP_03177; phage(gi148912772) 3e-42 Click
21complement(3271917..3272234) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp006; PP_03178; phage(gi148912771) 2e-49 Click
22complement(3272301..3274391) PHAGE_Pseudo_F10: Putative Clp protease; PP_03179; phage(gi148912770) 0.0 Click
23complement(3274366..3275559) PHAGE_Pseudo_F10: Putative portal protein; PP_03180; phage(gi148912769) 2e-153 Click
24complement(3276009..3276227) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp003; PP_03181; phage(gi148912768) 6e-10 Click
25complement(3276224..3278179) PHAGE_Pseudo_F10: Putative large subunit (GpA homolog) of DNA packaging dimer; PP_03182; phage(gi148912767) 0.0 Click
26complement(3278172..3278474) PHAGE_Pseudo_F10: Putative small subunit (Nu1 homolog) of DNA packaging dimer; PP_03183; phage(gi148912766) 5e-32 Click
27complement(3278837..3279580) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; PP_03184; phage(gi148912828) 1e-136 Click
283279610..3279843 hypothetical protein PLES_13481 [Pseudomonas aeruginosa LESB58] gi|218890088|ref|YP_002438952.1|; PP_03185 2e-36 Click
29complement(3280047..3280664) PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PP_03188; phage(gi148912826) 1e-109 Click
30complement(3280664..3280978) PHAGE_Aeromo_phiO18P: putative holin; PP_03186; phage(gi148727161) 3e-07 Click
313281175..3281360 hypothetical protein PLES_13451 [Pseudomonas aeruginosa LESB58] gi|218890085|ref|YP_002438949.1|; PP_03187 4e-27 Click
32complement(3281557..3281757) hypothetical; PP_03189 0.0 Click
33complement(3281986..3282273) hypothetical protein PLES_13431 [Pseudomonas aeruginosa LESB58] gi|218890083|ref|YP_002438947.1|; PP_03190 9e-47 Click
34complement(3282362..3282484) hypothetical; PP_03191 0.0 Click
35complement(3282655..3283236) PHAGE_Pseudo_PAJU2: putative NinG; PP_03192; phage(gi209552490) 2e-66 Click

Region 4, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15000579..5001397 PHAGE_Caulob_CcrColossus: putative dehalogenase hydrolase-like protein; PP_04852; phage(gi414088324) 8e-05 Click
25001470..5002948 anthranilate synthase component I [Pseudomonas aeruginosa UCBPP-PA14] gi|116054337|ref|YP_788782.1|; PP_04853 0.0 Click
3complement(5003265..5003579) PHAGE_Burkho_AH2: excisionase; PP_04854; phage(gi399529070) 1e-06 Click
4complement(5003679..5004449) PHAGE_Pseudo_F116: transcriptional regulator; PP_04855; phage(gi56692918) 9e-56 Click
5complement(5004534..5004704) hypothetical; PP_04856 0.0 Click
65004778..5005356 PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PP_04857; phage(gi148912826) 6e-42 Click
75005353..5005715 PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp28; PP_04858; phage(gi209552447) 9e-24 Click
85005829..5005969 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_04859; phage(gi374531678) 1e-10 Click
95006285..5006779 PHAGE_Pseudo_vB_PaeS_PMG1: putative major tail protein; PP_04860; phage(gi374531661) 6e-55 Click
105006791..5007138 hypothetical protein PA14_08220 [Pseudomonas aeruginosa UCBPP-PA14] gi|116054363|ref|YP_788808.1|; PP_04861 5e-58 Click
115007168..5007422 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_04862; phage(gi374531663) 5e-13 Click
125007469..5009307 PHAGE_Entero_HK542: tail length tape measure protein; PP_04863; phage(gi428783358) 3e-26 Click
135009300..5009641 PHAGE_Entero_mEp390: minor tail protein; PP_04864; phage(gi428782678) 1e-16 Click
145009649..5010344 PHAGE_Burkho_2: gp18, phage minor tail protein L; PP_04865; phage(gi134288683) 1e-66 Click
155010347..5011117 PHAGE_Cronob_ENT39118: minor tail protein; PP_04866; phage(gi431811059) 2e-55 Click
165011172..5011774 PHAGE_Cronob_ENT39118: tail assembly protein; PP_04867; phage(gi431811064) 1e-50 Click
175011833..5015447 PHAGE_Entero_HK106: central tail fiber J; PP_04868; phage(gi428783299) 0.0 Click
18complement(5015876..5016016) hypothetical; PP_04869 0.0 Click
195016738..5017586 PHAGE_Pseudo_LUZ7: hypothetical protein PP-LUZ7_gp056; PP_04870; phage(gi282599448) 7e-12 Click
205017775..5017921 hypothetical protein PA0644 [Pseudomonas aeruginosa PAO1] gi|15595841|ref|NP_249335.1|; PP_04871 5e-21 Click
215017953..5018132 PHAGE_Pseudo_LUZ7: hypothetical protein PP-LUZ7_gp054; PP_04872; phage(gi282599446) 2e-18 Click

Region 5, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15837247..5837326 attL    AAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT 0.0 Click
25839937..5840167 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p10; PP_05644; phage(gi9625376) 3e-38 Click
35840175..5840339 hypothetical; PP_05645 0.0 Click
45841171..5841605 PHAGE_Pseudo_Pf1: ssDNA binding protein; PP_05646; phage(gi9625367) 2e-78 Click
55841849..5841977 hypothetical protein PAM18_4776 [Pseudomonas aeruginosa M18] gi|386060836|ref|YP_005977358.1|; PP_05647 2e-15 Click
6complement(5842291..5842629) hypothetical; PP_05650 0.0 Click
75842597..5843412 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p05; PP_05648; phage(gi9625371) 4e-29 Click
85843422..5843772 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p06; PP_05649; phage(gi9625372) 2e-16 Click
95843774..5844814 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p07; PP_05651; phage(gi9625373) 1e-116 Click
105845300..5846592 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p08; PP_05652; phage(gi9625374) 0.0 Click
115846589..5847590 PHAGE_Erwini_ENT90: phage integrase family protein; PP_05653; phage(gi431810942) 8e-76 Click
125848087..5848166 attR    AAGGGGTTAGCTTGCGCTAACCCCTTGAAAAATATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT 0.0 Click

Region 6, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
16444855..6445073 PHAGE_Stenot_S1: hypothetical protein StPS1_gp38; PP_06241; phage(gi213163937) 2e-07 Click
26444913..6444924 attL    CCCTGGCCAAGG 0.0 Click
36445108..6448179 PHAGE_Stenot_S1: putative primase; PP_06242; phage(gi213163899) 1e-51 Click
46448928..6449293 PHAGE_Burkho_KL3: gp35; PP_06243; phage(gi327198080) 6e-18 Click
56449286..6449576 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_06244; phage(gi374531735) 2e-07 Click
66449579..6450316 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; PP_06245; phage(gi148912828) 1e-45 Click
7complement(6450643..6450783) hypothetical; PP_06247 0.0 Click
86450739..6451146 hypothetical protein Psefu_1447 [Pseudomonas fulva 12-X] gi|333899644|ref|YP_004473517.1|; PP_06246 2e-41 Click
96451240..6453162 PHAGE_Stenot_S1: putative terminase large subunit; PP_06248; phage(gi213163902) 6e-87 Click
106453174..6453398 preprotein translocase subunit SecA [Pseudomonas fulva 12-X] gi|333899646|ref|YP_004473519.1|; PP_06249 7e-18 Click
116453398..6454864 PHAGE_Stenot_S1: putative portal protein; PP_06250; phage(gi213163905) 9e-70 Click
126454848..6456020 PHAGE_Entero_mEp213: head maturation protease; PP_06251; phage(gi428782594) 2e-34 Click
136462888..6462899 attR    CCCTGGCCAAGG 0.0 Click

Region 7, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
16575425..6575436 attL    TCGTTGGTACGA 0.0 Click
26575980..6576453 PHAGE_Pseudo_Pf1: hypothetical protein Pf1p08; PP_06375; phage(gi9625374) 4e-56 Click
36576453..6576728 PROPHAGE_Pseudo_PAO1: bacteriophage integrase; PP_06376; phage(gi15595925) 7e-32 Click
46576836..6577372 PROPHAGE_Pseudo_PAO1: bacteriophage integrase; PP_06377; phage(gi15595925) 5e-56 Click
5complement(6577358..6579067) hypothetical protein NCGM2_1551 [Pseudomonas aeruginosa NCGM2.S1] gi|386064497|ref|YP_005979801.1|; PP_06378 0.0 Click
6complement(6579313..6580446) PHAGE_Cronob_phiES15: putative integrase; PP_06379; phage(gi401817566) 1e-55 Click
7complement(6580971..6581690) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp030; PP_06380; phage(gi148912795) 2e-111 Click
8complement(6581687..6581878) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp031; PP_06382; phage(gi148912796) 8e-31 Click
9complement(6581878..6582000) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp032; PP_06381; phage(gi148912797) 1e-14 Click
10complement(6581997..6582704) PHAGE_Pseudo_F10: Conserved hypothetical protein; potential EaA homolog; PP_06383; phage(gi148912798) 2e-54 Click
11complement(6582701..6583036) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp034; PP_06384; phage(gi148912799) 2e-55 Click
12complement(6583039..6583269) PHAGE_Pseudo_F10: hypothetical protein PPF10_gp035; PP_06385; phage(gi148912800) 3e-33 Click
13complement(6583313..6584149) PHAGE_Salmon_PVP_SE1: hypothetical protein; PP_06386; phage(gi363539639) 5e-66 Click
14complement(6584146..6584400) hypothetical protein NCGM2_1560 [Pseudomonas aeruginosa NCGM2.S1] gi|386064506|ref|YP_005979810.1|; PP_06387 4e-39 Click
156584561..6584932 hypothetical; PP_06388 0.0 Click
16complement(6584938..6585075) PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PP_06389; phage(gi148912803) 2e-12 Click
17complement(6585396..6585647) PHAGE_Entero_mEpX1: prophage repressor; PP_06390; phage(gi428781915) 2e-13 Click
186587166..6587393 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp043; PP_06391; phage(gi148912808) 4e-31 Click
196587636..6587944 hypothetical protein PLES_07981 [Pseudomonas aeruginosa LESB58] gi|218889542|ref|YP_002438406.1|; PP_06392 3e-14 Click
206587941..6588249 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp045; PP_06393; phage(gi148912810) 1e-46 Click
216588302..6588538 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp046; PP_06394; phage(gi148912811) 1e-31 Click
226588655..6588864 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp047; PP_06395; phage(gi148912812) 6e-35 Click
236589031..6589192 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp048; PP_06396; phage(gi148912813) 4e-24 Click
246589189..6589956 PHAGE_Pseudo_F10: Putative DNA-binding protein (Roi); PP_06397; phage(gi148912814) 3e-142 Click
256589953..6590183 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp050; PP_06398; phage(gi148912815) 5e-29 Click
266590807..6591019 hypothetical protein NCGM2_1569 [Pseudomonas aeruginosa NCGM2.S1] gi|386064515|ref|YP_005979819.1|; PP_06399 7e-36 Click
276591195..6591815 PHAGE_Pseudo_F10: DNA replication protein DnaC; PP_06400; phage(gi148912818) 4e-39 Click
286591812..6592417 PHAGE_Pseudo_F10: Putative DnaB-like replicative helicase; PP_06401; phage(gi148912819) 6e-22 Click
296592420..6592569 PHAGE_Pseudo_F10: Putative DnaB-like replicative helicase; PP_06402; phage(gi148912819) 3e-05 Click
306592607..6593212 PHAGE_Pseudo_F10: Putative DnaB-like replicative helicase; PP_06403; phage(gi148912819) 5e-53 Click
316593209..6593487 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp057; PP_06404; phage(gi148912822) 8e-44 Click
326593505..6593873 PHAGE_Pseudo_PAJU2: putative antitermination protein Q; PP_06405; phage(gi209552491) 6e-10 Click
336594317..6594451 hypothetical; PP_06406 0.0 Click
346594662..6595192 PHAGE_Pseudo_F10: Conserved hypothetical protein; hypothetical Rha protein; PP_06407; phage(gi148912824) 7e-87 Click
356595277..6595609 PHAGE_Pseudo_F10: Putative Holin; PP_06408; phage(gi148912825) 8e-60 Click
366595606..6596223 PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PP_06409; phage(gi148912826) 5e-105 Click
376596298..6596462 hypothetical; PP_06410 0.0 Click
386596459..6596971 PHAGE_Pseudo_F10: Putative lysis protein Rz; PP_06411; phage(gi148912827) 4e-72 Click
396596984..6597166 PHAGE_Pseudo_D3: Orf93; PP_06412; phage(gi9635601) 2e-06 Click
406597196..6597495 PHAGE_Pseudo_PAJU2: putative endonuclease; PP_06413; phage(gi209552497) 8e-28 Click
416597643..6598134 PHAGE_Burkho_Bcep176: gp80; PP_06414; phage(gi77864706) 4e-17 Click
426598138..6599817 PHAGE_Entero_4795: putative large subunit terminase; PP_06415; phage(gi157166040) 0.0 Click
436599856..6601043 PHAGE_Entero_mEp235: portal protein; PP_06416; phage(gi428781813) 2e-46 Click
446601027..6601671 PHAGE_Marino_P12026: phage prohead protease; PP_06417; phage(gi399528321) 2e-22 Click
456601668..6602882 PHAGE_Cronob_ENT39118: major capsid protein; PP_06418; phage(gi431811052) 1e-59 Click
466602934..6603137 hypothetical protein NCGM2_1584 [Pseudomonas aeruginosa NCGM2.S1] gi|386064530|ref|YP_005979834.1|; PP_06419 5e-31 Click
476603137..6603466 PHAGE_Entero_mEp235: head-tail connector II; PP_06420; phage(gi428781817) 1e-11 Click
486603846..6604274 PHAGE_Entero_mEpX2: hypothetical protein; PP_06421; phage(gi428765623) 1e-24 Click
496604409..6604642 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_06422; phage(gi374531660) 9e-24 Click
506604784..6605203 PHAGE_Pseudo_vB_PaeS_PMG1: putative major tail protein; PP_06423; phage(gi374531661) 5e-52 Click
516605213..6605563 hypothetical protein PSPA7_0778 [Pseudomonas aeruginosa PA7] gi|152988647|ref|YP_001346173.1|; PP_06424 4e-33 Click
526605593..6605859 PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PP_06425; phage(gi374531663) 9e-11 Click
536606385..6609516 PHAGE_Pseudo_MP38: putative tail component protein; PP_06426; phage(gi215479964) 4e-137 Click
54complement(6610681..6610929) hypothetical; PP_06427 0.0 Click
55complement(6611278..6611736) hypothetical protein PFL_6275 [Pseudomonas protegens Pf-5] gi|346643062|ref|YP_004842350.1|; PP_06428 3e-31 Click
566612055..6612756 PHAGE_Burkho_2: gp18, phage minor tail protein L; PP_06429; phage(gi134288683) 3e-50 Click
576613186..6613404 PHAGE_Gifsy_2: bacteriophage tail tip assembly protein; Lambda gpK homolog; PP_06430; phage(gi169257315) 2e-06 Click
586613394..6613543 hypothetical protein PSPA7_0783 [Pseudomonas aeruginosa PA7] gi|152983726|ref|YP_001346178.1|; PP_06431 1e-07 Click
59complement(6613606..6613791) hypothetical; PP_06432 0.0 Click
606613837..6614118 PHAGE_Entero_HK225: tail assembly protein I; PP_06433; phage(gi428782395) 4e-18 Click
616614174..6617881 PHAGE_Entero_mEp237: central tail fiber; PP_06434; phage(gi435439285) 0.0 Click
626617878..6618015 hypothetical; PP_06435 0.0 Click
636618322..6618825 PHAGE_Pseudo_LIT1: hypothetical protein PP-LIT1_gp54; PP_06436; phage(gi282598901) 7e-21 Click
646618963..6618974 attR    TCGTTGGTACGA 0.0 Click
656618985..6619638 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp025; PP_06437; phage(gi148912790) 3e-31 Click
666619728..6619952 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp026; PP_06438; phage(gi148912791) 4e-05 Click