Escherichia coli 53638 , whole genome shotgun [asmbl_id: NC_000000].5071018, GC%: 51.10%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
134..552 PROPHAGE_Escher_CFT073: transposase/IS protein; Ec53638_0001; phage(gi26248359) 1e-40 Click
2complement(562..831) PHAGE_Entero_HK620: endopeptidase; Ec53638_0002; phage(gi13559860) 1e-33 Click
3complement(828..1325) PHAGE_Stx2_c_1717: phage-related lysozyme; Ec53638_0003; phage(gi209447172) 2e-93 Click
4complement(1325..1540) PHAGE_Escher_P13374: lysis protein, holin; Ec53638_0004; phage(gi410491645) 1e-27 Click
5complement(1831..1905) tRNA 0.0 Click
6complement(1909..1984) tRNA 0.0 Click
7complement(1987..2063) tRNA 0.0 Click
8complement(2065..2141) tRNA 0.0 Click
9complement(2348..2890) conserved hypothetical protein; Ec53638_0010 0.0 Click
10complement(2887..3177) PHAGE_Erwini_phiEt88: hypothetical protein; Ec53638_0012; phage(gi327198620) 5e-33 Click
11complement(3177..3776) PHAGE_Entero_mEp237: hypothetical protein; Ec53638_0013; phage(gi435439315) 9e-54 Click
123958..4599 PHAGE_Stx2_c_1717: truncated transposase; Ec53638_0014; phage(gi209447151) 5e-16 Click
134599..4946 PHAGE_Stx2_c_1717: transposase; Ec53638_0015; phage(gi209447152) 2e-45 Click
144966..6537 PHAGE_Stx2_c_1717: transposase; Ec53638_0016; phage(gi209447153) 9e-171 Click
15complement(6564..6707) hypothetical protein; Ec53638_0017 0.0 Click
16complement(6880..7698) PHAGE_Cronob_phiES15: hypothetical protein; Ec53638_0018; phage(gi401817564) 6e-07 Click

Region 2, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
18573..8584 attL    CCGCCAGTATTC 0.0 Click
219277..19831 PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; Ec53638_0038; phage(gi418487059) 1e-42 Click
320204..20500 PHAGE_Gifsy_2: hypothetical protein STM1010.Gifsy2; Ec53638_0039; phage(gi169257273) 3e-05 Click
4complement(20617..21963) PROPHAGE_Escher_MG1655: IS4 transposase; Ec53638_0040; phage(gi16132099) 0.0 Click
522159..23904 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; Ec53638_0041; phage(gi169257272) 4e-37 Click
623882..24178 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; Ec53638_0042; phage(gi116222045) 1e-43 Click
724184..25281 PHAGE_Cronob_phiES15: hypothetical protein; Ec53638_0043; phage(gi401817570) 0.0 Click
825576..25587 attR    CCGCCAGTATTC 0.0 Click
925874..26950 PHAGE_Entero_mEp235: integrase; Ec53638_0044; phage(gi428781836) 7e-71 Click
10complement(27343..27684) PHAGE_Entero_PsP3: gp28; Ec53638_0045; phage(gi41057381) 6e-09 Click
11complement(27697..28569) copper resistance protein D; Ec53638_0046 0.0 Click
12complement(28573..28947) copper resistance protein CopC; Ec53638_0047 0.0 Click
1329086..29316 PHAGE_Pectob_ZF40: putative DNA polymerase; Ec53638_0048; phage(gi422936677) 6e-17 Click

Region 3, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
144403..44417 attL    CCTGCTGGTTTATCC 0.0 Click
2complement(56428..56604) PHAGE_Entero_phiP27: hypothetical protein P27p58; Ec53638_0078; phage(gi18249922) 2e-12 Click
356701..56949 PHAGE_Entero_mEp460: DinI-like protein; Ec53638_0079; phage(gi428782337) 1e-41 Click
458177..59301 invasion plasmid antigen; Ec53638_0080 0.0 Click
5complement(59481..60044) PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_0081; phage(gi18249921) 1e-81 Click
6complement(60055..61512) PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_0082; phage(gi18249920) 4e-73 Click
7complement(61534..62133) PHAGE_Entero_mEp460: Lom protein; Ec53638_0083; phage(gi428782335) 8e-109 Click
8complement(62203..65700) PHAGE_Entero_mEp460: host specificity protein; Ec53638_0084; phage(gi428782334) 0.0 Click
9complement(65761..66303) PHAGE_Entero_mEp460: tail assembly protein; Ec53638_0085; phage(gi428782333) 1e-80 Click
10complement(66300..66899) PHAGE_Entero_mEp460: tail fiber component; Ec53638_0086; phage(gi428782332) 2e-115 Click
11complement(67048..67746) PHAGE_Entero_mEp460: minor tail protein; Ec53638_0087; phage(gi428782331) 5e-126 Click
12complement(67756..68085) PHAGE_Entero_mEp460: minor tail protein; Ec53638_0088; phage(gi428782330) 2e-59 Click
13complement(68085..71126) PHAGE_Entero_mEp460: tail length tape measure protein; Ec53638_0089; phage(gi428782329) 0.0 Click
14complement(71098..71415) PHAGE_Entero_mEp460: tail assembly protein; Ec53638_0090; phage(gi428782328) 1e-56 Click
15complement(71436..71822) PHAGE_Entero_mEp460: minor tail protein; Ec53638_0091; phage(gi428782327) 4e-63 Click
16complement(71881..72621) PHAGE_Entero_mEp460: major tail protein; Ec53638_0092; phage(gi428782326) 3e-134 Click
17complement(73601..73978) PHAGE_Entero_HK630: head-tail connector Fii; Ec53638_0095; phage(gi428782797) 6e-33 Click
18complement(73990..74376) PHAGE_Entero_HK630: DNA packaging protein Fi; Ec53638_0096; phage(gi428782796) 8e-20 Click
19complement(74428..75456) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; Ec53638_0097; phage(gi169257230) 1e-172 Click
20complement(75514..75861) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; Ec53638_0098; phage(gi169257231) 1e-42 Click
21complement(75898..77403) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; Ec53638_0099; phage(gi169257232) 3e-175 Click
22complement(77393..78985) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; Ec53638_0100; phage(gi169257233) 0.0 Click
23complement(78982..79185) PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; Ec53638_0101; phage(gi169257234) 8e-14 Click
24complement(79169..81097) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; Ec53638_0102; phage(gi169257235) 0.0 Click
25complement(81069..81578) PHAGE_Entero_N15: gp1; Ec53638_0103; phage(gi9630465) 2e-18 Click
2681975..82151 hypothetical protein; Ec53638_0105 0.0 Click
27complement(82228..82485) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp50; Ec53638_0106; phage(gi209447175) 2e-43 Click
28complement(82482..82979) PHAGE_Entero_HK620: hypothetical protein HK620p38; Ec53638_0107; phage(gi13559861) 3e-95 Click
29complement(83184..83621) PHAGE_Escher_P13374: endopeptidase; Ec53638_0108; phage(gi410491649) 2e-63 Click
30complement(83623..83736) conserved hypothetical protein; Ec53638_0109 0.0 Click
31complement(83957..84490) PHAGE_Entero_mEp460: endolysin; Ec53638_0110; phage(gi428782372) 5e-98 Click
32complement(84812..85342) PHAGE_Entero_mEp460: hypothetical protein; Ec53638_0111; phage(gi428782371) 4e-37 Click
33complement(85347..85562) PHAGE_Entero_mEp460: porin; Ec53638_0112; phage(gi428782370) 2e-32 Click
34complement(85630..86682) PHAGE_Entero_mEp460: DNA methylase; Ec53638_0113; phage(gi428782369) 0.0 Click
35complement(86833..87117) PHAGE_Entero_mEp460: hypothetical protein; Ec53638_0114; phage(gi428782368) 3e-08 Click
36complement(87255..87530) PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; Ec53638_0115; phage(gi169257243) 1e-11 Click
37complement(88098..88484) PHAGE_Entero_2008: antitermination protein Q; Ec53638_0116; phage(gi209427762) 4e-59 Click
38complement(88490..88852) PHAGE_Escher_HK75: RusA-like protein; Ec53638_0117; phage(gi356870726) 1e-35 Click
39complement(88853..89917) PHAGE_Entero_mEp460: hypothetical protein; Ec53638_0118; phage(gi428782365) 8e-88 Click
40complement(90812..91327) PHAGE_Salmon_ST64B: hypothetical protein sb32; Ec53638_0119; phage(gi23505476) 4e-11 Click
41complement(91324..91500) PHAGE_Shigel_AG3: hypothetical protein; Ec53638_0120; phage(gi282599330) 1e-14 Click
42complement(91493..91609) conserved hypothetical protein; Ec53638_0121 0.0 Click
43complement(91771..92226) PHAGE_Entero_ES18: gp41; Ec53638_0122; phage(gi62362254) 5e-30 Click
44complement(92213..92512) PHAGE_Klebsi_phiKO2: Gp58; Ec53638_0123; phage(gi46402144) 7e-24 Click
45complement(92943..93689) PHAGE_Gifsy_2: bacteriophage DNA replication protein; Ec53638_0124; phage(gi169257280) 3e-79 Click
46complement(93696..94661) PHAGE_Erwini_PEp14: putative phage O family protein; Ec53638_0125; phage(gi374531901) 5e-39 Click
47complement(94683..95108) PHAGE_Escher_HK639: cII; Ec53638_0126; phage(gi356870652) 2e-05 Click
4895496..95867 conserved hypothetical protein; Ec53638_0127 0.0 Click
4996328..96519 conserved domain protein; Ec53638_0128 0.0 Click
5097223..97600 hypothetical protein; Ec53638_0130 0.0 Click
5198201..99055 PHAGE_Entero_mEp460: regulatory protein Rha; Ec53638_0131; phage(gi428782357) 5e-61 Click
5299066..99254 division inhibition protein DicB; Ec53638_0132 0.0 Click
5399251..99442 conserved hypothetical protein; Ec53638_0133 0.0 Click
5499536..101977 PHAGE_Entero_mEp460: putative exonuclease; Ec53638_0134; phage(gi428782342) 2e-58 Click
55102039..102308 putative excisionase; Ec53638_0135 0.0 Click
56102277..103395 PHAGE_Entero_mEp235: integrase; Ec53638_0136; phage(gi428781836) 6e-52 Click
57112951..112965 attR    CCTGCTGGTTTATCC 0.0 Click

Region 4, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1362913..364634 PHAGE_Bacill_SPBc2: ABC transporter; Ec53638_0393; phage(gi9630145) 4e-17 Click
2364635..364646 attL    GCTATTATTGAA 0.0 Click
3364676..365380 leucyl/phenylalanyl-tRNA--protein transferase; Ec53638_0394 0.0 Click
4365665..365883 translation initiation factor IF-1; Ec53638_0395 0.0 Click
5366136..366225 tRNA 0.0 Click
6complement(366684..368960) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; Ec53638_0397; phage(gi15800640) 0.0 Click
7complement(368991..369311) PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; Ec53638_0398; phage(gi414087232) 2e-05 Click
8complement(370366..370650) hypothetical bacteriophage protein; Ec53638_0399 0.0 Click
9370829..370951 hypothetical protein; Ec53638_0400 0.0 Click
10complement(371036..371449) conserved hypothetical protein; Ec53638_0401 0.0 Click
11complement(371462..371797) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; Ec53638_0402; phage(gi169257231) 2e-08 Click
12complement(371809..372864) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; Ec53638_0403; phage(gi169257230) 6e-83 Click
13complement(372864..373103) conserved hypothetical protein; Ec53638_0404 0.0 Click
14373209..373376 hypothetical protein; Ec53638_0405 0.0 Click
15complement(373485..373907) PHAGE_Pseudo_F116: single-stranded DNA-binding protein; Ec53638_0406; phage(gi56692915) 1e-09 Click
16complement(373904..374161) conserved hypothetical protein; Ec53638_0407 0.0 Click
17complement(374452..376206) PHAGE_Entero_P4: DNA primase; Ec53638_0408; phage(gi9627512) 1e-90 Click
18complement(376203..376490) hypothetical protein; Ec53638_0409 0.0 Click
19complement(376496..376723) hypothetical protein; Ec53638_0410 0.0 Click
20complement(376723..376851) hypothetical protein; Ec53638_0411 0.0 Click
21complement(377177..378424) PHAGE_Entero_SfV: immunity region; Ec53638_0412; phage(gi19549024) 2e-14 Click
22complement(378435..378644) PHAGE_Entero_P4: transcriptional regulator; Ec53638_0413; phage(gi9627517) 2e-09 Click
23378840..379049 hypothetical protein; Ec53638_0414 0.0 Click
24complement(379054..380292) PHAGE_Salmon_vB_SosS_Oslo: integrase; Ec53638_0415; phage(gi399528791) 2e-49 Click
25380697..380921 PHAGE_Lactoc_bIL312: Csp; Ec53638_0416; phage(gi13095918) 3e-14 Click
26complement(380994..382940) PHAGE_Plankt_PaV_LD: ABC transporter; Ec53638_0417; phage(gi371496158) 4e-40 Click
27complement(382937..384052) macrolide-specific efflux protein MacA; Ec53638_0418 0.0 Click
28384167..385159 conserved hypothetical protein; Ec53638_0420 0.0 Click
29complement(385156..386814) PHAGE_Entero_P2: Old; Ec53638_0419; phage(gi9630369) 6e-06 Click
30398750..398761 attR    GCTATTATTGAA 0.0 Click

Region 5, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(949585..949719) PHAGE_Entero_P4: hypothetical protein P4p05; Ec53638_0976; phage(gi19263411) 2e-16 Click
2949904..950545 PHAGE_Stx2_c_1717: truncated transposase; Ec53638_0977; phage(gi209447151) 5e-16 Click
3950545..950892 PHAGE_Stx2_c_1717: transposase; Ec53638_0978; phage(gi209447152) 2e-45 Click
4950912..952483 PHAGE_Stx2_c_1717: transposase; Ec53638_0979; phage(gi209447153) 9e-171 Click
5952575..952700 hypothetical protein; Ec53638_0981 0.0 Click
6complement(952655..954988) PHAGE_Entero_P4: DNA primase; Ec53638_0980; phage(gi9627512) 0.0 Click
7complement(955003..955323) PHAGE_Entero_P4: hypothetical protein P4p07; Ec53638_0982; phage(gi9627513) 6e-57 Click
8complement(955459..955914) PHAGE_Entero_P4: hypothetical protein P4p08; Ec53638_0983; phage(gi9627514) 9e-88 Click
9complement(955907..956194) PHAGE_Entero_P4: helper derepression protein; Ec53638_0984; phage(gi9627515) 4e-50 Click
10complement(956187..956384) PHAGE_Entero_P4: putative CI repressor; Ec53638_0985; phage(gi9627516) 2e-29 Click
11complement(956738..956956) PHAGE_Entero_P4: transcriptional regulator; Ec53638_0986; phage(gi9627517) 9e-37 Click
12957556..958290 PHAGE_Entero_P4: head size determination protein sid; Ec53638_0987; phage(gi9627518) 4e-134 Click
13958287..958787 PHAGE_Entero_P4: transactivation protein; Ec53638_0988; phage(gi9627519) 1e-92 Click
14958861..959433 PHAGE_Entero_P4: amber mutation-suppressing protein; Ec53638_0989; phage(gi9627520) 1e-102 Click

Region 6, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1121698..1122084) PHAGE_Burkho_BcepMu: gp01; Ec53638_1157; phage(gi48696911) 8e-31 Click
2complement(1122056..1122505) PHAGE_Burkho_BcepMu: gp02; Ec53638_1158; phage(gi48696912) 8e-26 Click
3complement(1122498..1122713) hypothetical protein; Ec53638_1159 0.0 Click
4complement(1122703..1122933) conserved hypothetical protein; Ec53638_1160 0.0 Click
5complement(1122930..1123613) PHAGE_Pseudo_JBD24: hypothetical protein; Ec53638_1161; phage(gi448245062) 1e-28 Click
6complement(1123841..1124137) conserved hypothetical protein; Ec53638_1163 0.0 Click
7complement(1124147..1124419) conserved hypothetical protein; Ec53638_1164 0.0 Click
81124524..1124697 hypothetical protein; Ec53638_1165 0.0 Click
9complement(1124708..1125238) PHAGE_Pseudo_MP42: host nuclease inhibitor protein; Ec53638_1166; phage(gi399528592) 8e-61 Click
10complement(1125266..1125535) conserved hypothetical protein; Ec53638_1167 0.0 Click
11complement(1125538..1126704) PHAGE_Burkho_BcepMu: gp08; Ec53638_1168; phage(gi48696918) 8e-124 Click
12complement(1126715..1128484) PHAGE_Burkho_BcepMu: gp09; Ec53638_1169; phage(gi48696919) 0.0 Click
13complement(1128500..1128817) hypothetical protein; Ec53638_1170 0.0 Click
14complement(1128817..1129734) PHAGE_Burkho_BcepMu: gp10; Ec53638_1171; phage(gi48696920) 5e-45 Click
15complement(1129745..1130059) PHAGE_Burkho_BcepMu: gp12; Ec53638_1172; phage(gi48696922) 4e-09 Click
16complement(1130112..1130300) PHAGE_Burkho_BcepMu: gp16; Ec53638_1173; phage(gi48696926) 2e-08 Click
171130617..1130739 hypothetical protein; Ec53638_1174 0.0 Click
18complement(1130856..1131620) PHAGE_Vibrio_VP882: DNA adenine methylase; Ec53638_1175; phage(gi126010878) 2e-98 Click
19complement(1132021..1132275) hypothetical protein; Ec53638_1176 0.0 Click
20complement(1132351..1132776) hypothetical protein; Ec53638_1177 0.0 Click
211132907..1133257 PHAGE_Burkho_BcepMu: gp21; Ec53638_1178; phage(gi48696931) 1e-26 Click
221133260..1134000 PHAGE_Burkho_BcepMu: gp22; Ec53638_1179; phage(gi48696932) 4e-62 Click
231133984..1134634 PHAGE_Burkho_BcepMu: gp23; Ec53638_1180; phage(gi48696933) 7e-10 Click
241134631..1134957 PHAGE_Burkho_BcepMu: gp25; Ec53638_1181; phage(gi48696935) 8e-22 Click
251134957..1135268 PHAGE_Burkho_BcepMu: gp26; Ec53638_1182; phage(gi48696936) 2e-29 Click
261135271..1135819 PHAGE_Burkho_BcepMu: gp27; Ec53638_1183; phage(gi48696937) 4e-40 Click
271135816..1137132 PHAGE_Burkho_BcepMu: gp28; Ec53638_1184; phage(gi48696938) 4e-24 Click
281137132..1138628 PHAGE_Burkho_BcepMu: gp29; Ec53638_1185; phage(gi48696939) 5e-168 Click
291138609..1139430 PHAGE_Burkho_BcepMu: gp30; Ec53638_1186; phage(gi48696940) 1e-96 Click
301139433..1139891 PHAGE_Burkho_BcepMu: gp31; Ec53638_1187; phage(gi48696941) 5e-33 Click
311140106..1141221 PHAGE_Burkho_BcepMu: gp32; Ec53638_1188; phage(gi48696942) 6e-99 Click
321141236..1142189 PHAGE_Burkho_BcepMu: gp34; Ec53638_1189; phage(gi48696944) 1e-67 Click
331142199..1142537 PHAGE_Burkho_BcepMu: gp35; Ec53638_1190; phage(gi48696945) 5e-22 Click
341142539..1142985 PHAGE_Burkho_BcepMu: gp36; Ec53638_1191; phage(gi48696946) 2e-36 Click
351142985..1143449 PHAGE_Burkho_BcepMu: gp37; Ec53638_1192; phage(gi48696947) 2e-41 Click
361143449..1143700 PHAGE_Burkho_BcepMu: gp38; Ec53638_1193; phage(gi48696948) 6e-09 Click
371143690..1145117 PHAGE_Burkho_BcepMu: gp39; Ec53638_1194; phage(gi48696949) 0.0 Click
381145117..1145638 PHAGE_Burkho_BcepMu: gp40; Ec53638_1195; phage(gi48696950) 7e-68 Click
391146008..1146343 PHAGE_Burkho_BcepMu: gp41; Ec53638_1196; phage(gi48696951) 4e-05 Click
401146501..1148978 PHAGE_Burkho_BcepMu: gp44; Ec53638_1197; phage(gi48696954) 2e-112 Click
411148978..1149862 PHAGE_Burkho_BcepMu: gp45; Ec53638_1198; phage(gi48696955) 8e-75 Click
421149862..1150074 PHAGE_Burkho_BcepMu: gp46; Ec53638_1199; phage(gi48696956) 8e-20 Click
431150062..1151216 PHAGE_Burkho_BcepMu: gp47; Ec53638_1200; phage(gi48696957) 4e-89 Click
441151213..1151725 PHAGE_Burkho_BcepMu: gp48; Ec53638_1201; phage(gi48696958) 4e-29 Click
451151782..1152129 PHAGE_Burkho_BcepMu: gp49; Ec53638_1202; phage(gi48696959) 9e-35 Click
461152120..1153223 PHAGE_Burkho_BcepMu: gp50; Ec53638_1203; phage(gi48696960) 7e-111 Click
471153216..1153794 PHAGE_Burkho_BcepMu: gp51; Ec53638_1204; phage(gi48696961) 2e-62 Click
481153797..1155242 PHAGE_Entero_Mu: tail fiber fragment; Ec53638_1205; phage(gi19584574) 0.0 Click
491155245..1155778 PHAGE_Entero_Mu: tail fiber assembly protein; Ec53638_1206; phage(gi19584573) 1e-96 Click
50complement(1155807..1156352) PHAGE_Escher_D108: probable tail fiber assembly protein; Ec53638_1207; phage(gi281199695) 2e-90 Click
51complement(1156336..1157301) PHAGE_Entero_Mu: tail fiber; Ec53638_1208; phage(gi9633540) 7e-115 Click
521157427..1157999 PHAGE_Entero_2: DNA-invertase; Ec53638_1209; phage(gi169936026) 1e-82 Click
531158150..1159430 PHAGE_Mycoba_Myrna: gp183; Ec53638_1210; phage(gi203454746) 4e-08 Click

Region 7, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1832647..1833609) PHAGE_Ostreo_OlV5: 6-phosphofructokinase; Ec53638_1862; phage(gi472341206) 4e-16 Click
2complement(1833790..1834692) cation-efflux pump FieF; Ec53638_1863 0.0 Click
3complement(1834929..1835147) PHAGE_Yersin_413C: Ogr; Ec53638_1864; phage(gi30065732) 3e-39 Click
4complement(1835229..1836392) PHAGE_Yersin_413C: gpD; Ec53638_1865; phage(gi30065731) 0.0 Click
51836242..1836253 attL    CAAGCTGGTCAG 0.0 Click
6complement(1836392..1836871) PHAGE_Yersin_413C: gpU; Ec53638_1866; phage(gi30065730) 3e-85 Click
7complement(1836886..1839333) PHAGE_Yersin_413C: gpT; Ec53638_1867; phage(gi30065729) 0.0 Click
8complement(1839810..1840328) PHAGE_Yersin_413C: FII; Ec53638_1869; phage(gi30065726) 6e-93 Click
9complement(1840341..1841531) PHAGE_Yersin_413C: gpFI; Ec53638_1870; phage(gi30065725) 0.0 Click
101841551..1841667 hypothetical protein; Ec53638_1871 0.0 Click
11complement(1841861..1842310) putative lysogenic conversion protein; Ec53638_1872 0.0 Click
12complement(1842676..1843203) PHAGE_Yersin_413C: gpG; Ec53638_1873; phage(gi30065723) 3e-76 Click
13complement(1843207..1845285) PHAGE_Yersin_413C: gpH; Ec53638_1874; phage(gi30065722) 1e-97 Click
14complement(1845296..1845826) PHAGE_Yersin_413C: gpI; Ec53638_1875; phage(gi30065721) 6e-96 Click
15complement(1845819..1846727) PHAGE_Yersin_413C: gpJ; Ec53638_1876; phage(gi30065720) 5e-165 Click
16complement(1846732..1847079) PHAGE_Yersin_413C: gpW; Ec53638_1877; phage(gi30065719) 8e-60 Click
17complement(1847076..1847711) PHAGE_Yersin_413C: gpV; Ec53638_1878; phage(gi30065718) 2e-117 Click
18complement(1847778..1848230) PHAGE_Yersin_413C: gpS; Ec53638_1879; phage(gi30065717) 1e-79 Click
19complement(1848223..1848690) PHAGE_Yersin_413C: gpR; Ec53638_1880; phage(gi30065716) 6e-83 Click
20complement(1848653..1848826) PHAGE_Erwini_ENT90: putative host lysis-related protein; Ec53638_1881; phage(gi431810968) 4e-12 Click
21complement(1848798..1849223) PHAGE_Yersin_413C: LysB; Ec53638_1882; phage(gi30065715) 1e-69 Click
22complement(1849211..1849636) PHAGE_Yersin_413C: LysA; Ec53638_1883; phage(gi30065714) 9e-68 Click
23complement(1849651..1850148) PHAGE_Yersin_413C: gpK; Ec53638_1884; phage(gi30065713) 3e-94 Click
24complement(1850148..1850429) PHAGE_Yersin_413C: gpY; Ec53638_1885; phage(gi30065712) 3e-46 Click
25complement(1850433..1850636) PHAGE_Yersin_413C: gpX; Ec53638_1886; phage(gi30065711) 1e-32 Click
26complement(1850636..1851109) PHAGE_Yersin_413C: gpL; Ec53638_1887; phage(gi30065710) 2e-84 Click
27complement(1851245..1851988) PHAGE_Yersin_413C: gpM; Ec53638_1888; phage(gi30065709) 4e-134 Click
28complement(1851992..1853065) PHAGE_Yersin_413C: gpN; Ec53638_1889; phage(gi30065708) 0.0 Click
29complement(1853124..1853978) PHAGE_Yersin_413C: gpO; Ec53638_1890; phage(gi30065707) 8e-160 Click
301854152..1855924 PHAGE_Yersin_413C: gpP; Ec53638_1891; phage(gi30065706) 0.0 Click
311855924..1856958 PHAGE_Yersin_413C: gpQ; Ec53638_1892; phage(gi30065705) 0.0 Click
32complement(1856997..1857158) hypothetical protein; Ec53638_1893 0.0 Click
331857737..1858513 PHAGE_Entero_cdtI: Cytolethal distending toxin A subunit; Ec53638_1894; phage(gi148609409) 7e-39 Click
341858510..1859319 PHAGE_Entero_cdtI: Cytolethal distending toxin B subunit; Ec53638_1895; phage(gi148609410) 2e-78 Click
351859334..1859879 PHAGE_Entero_cdtI: Cytolethal distending toxin C subunit; Ec53638_1896; phage(gi148609411) 3e-20 Click
36complement(1859955..1862252) PHAGE_Yersin_413C: gpA; Ec53638_1897; phage(gi30065742) 0.0 Click
37complement(1862242..1862517) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; Ec53638_1898; phage(gi30065741) 1e-46 Click
38complement(1862514..1862738) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; Ec53638_1899; phage(gi30065740) 1e-35 Click
39complement(1863040..1863264) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; Ec53638_1900; phage(gi30065738) 5e-33 Click
40complement(1863328..1863828) PHAGE_Yersin_413C: gpB; Ec53638_1901; phage(gi30065737) 2e-93 Click
41complement(1863825..1863995) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; Ec53638_1902; phage(gi30065736) 1e-26 Click
42complement(1863998..1864270) PHAGE_Yersin_413C: Cox; Ec53638_1903; phage(gi30065735) 6e-39 Click
431864633..1864644 attR    CAAGCTGGTCAG 0.0 Click
441864786..1865769 PHAGE_Yersin_413C: Int; Ec53638_1904; phage(gi30065733) 0.0 Click
45complement(1865770..1866006) hypothetical protein; Ec53638_1905 0.0 Click
46complement(1866517..1867017) conserved hypothetical protein; Ec53638_1906 0.0 Click
471867167..1867865 PHAGE_Feldma_virus: putative sensor histidine kinase; Ec53638_1907; phage(gi197322366) 4e-09 Click
481867862..1869235 PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; Ec53638_1908; phage(gi197322490) 1e-08 Click

Region 8, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2038959..2040464) PHAGE_Plankt_PaV_LD: ABC transporter; Ec53638_2085; phage(gi371496158) 5e-14 Click
2complement(2040472..2040891) cytoplasmic D-ribose-binding protein RbsD; Ec53638_2086 0.0 Click
3complement(2041058..2042926) PHAGE_Parame_FR483: hypothetical protein FR483_N110R; Ec53638_2087; phage(gi155370208) 2e-72 Click
4complement(2043085..2044269) PROPHAGE_Escher_MG1655: IS4 transposase; Ec53638_2088; phage(gi16132099) 0.0 Click
5complement(2044254..2045159) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; Ec53638_2089; phage(gi16130763) 5e-178 Click
62045446..2046618 PROPHAGE_Escher_CFT073: transposase; Ec53638_2091; phage(gi26248360) 1e-34 Click
72046618..2047415 PHAGE_Bacill_phIS3501: phage replication protein DnaC; Ec53638_2092; phage(gi422934308) 4e-08 Click
8complement(2047425..2047616) PROPHAGE_Escher_CFT073: transposase insC; Ec53638_2093; phage(gi26250372) 3e-20 Click
9complement(2047692..2047901) PROPHAGE_Escher_MG1655: IS4 transposase; Ec53638_2094; phage(gi16132099) 5e-29 Click
102048033..2049553 PHAGE_Acidia_virus: hypothetical protein ATV_gp66; Ec53638_2095; phage(gi75750456) 5e-15 Click
112049547..2050998 PHAGE_Bacill_36: putative metalloprotein chaperonin subunit; Ec53638_2096; phage(gi156564046) 3e-05 Click

Region 9, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3212914..3213978) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; Ec53638_3262; phage(gi163932195) 1e-05 Click
2complement(3213971..3215173) PHAGE_Plankt_PaV_LD: ABC transporter; Ec53638_3263; phage(gi371496158) 1e-24 Click
3complement(3215528..3216487) PHAGE_Mycoba_Myrna: gp256; Ec53638_3264; phage(gi203454817) 4e-129 Click
4complement(3216497..3218641) PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; Ec53638_3265; phage(gi158079505) 0.0 Click
5complement(3218614..3219024) PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; Ec53638_3266; phage(gi418489617) 7e-14 Click
6complement(3219021..3219266) PHAGE_Mycoba_Porky: gp37; Ec53638_3267; phage(gi194303333) 3e-10 Click
7complement(3219514..3219843) conserved hypothetical protein; Ec53638_3268 0.0 Click
83219995..3220339 conserved hypothetical protein; Ec53638_3269 0.0 Click
9complement(3220376..3220825) putative membrane protein; Ec53638_3270 0.0 Click
103221565..3222068 PROPHAGE_Escher_MG1655: IS1 transposase B; Ec53638_3272; phage(gi16131317) 4e-96 Click

Region 10, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3328202..3328885) PHAGE_Sphing_PAU: gp60; Ec53638_3386; phage(gi435844563) 3e-05 Click
2complement(3328882..3330066) type I restriction-modification system specificity subunit; Ec53638_3387 0.0 Click
3complement(3330056..3331579) PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; Ec53638_3388; phage(gi423261981) 3e-22 Click
43332186..3332527 PHAGE_Entero_SfV: holin; Ec53638_3389; phage(gi19549036) 1e-55 Click
53332531..3333007 PHAGE_Entero_SfV: lysin; Ec53638_3390; phage(gi19549037) 7e-87 Click
63332991..3333515 PHAGE_Entero_HK225: lysis protein Rz; Ec53638_3391; phage(gi428782445) 5e-44 Click
73333577..3334149 PHAGE_Pseudo_phi297: terminase small subunit; Ec53638_3392; phage(gi374531284) 5e-49 Click
83334152..3335771 PHAGE_Burkho_BcepB1A: gp33 TerL; Ec53638_3393; phage(gi48697520) 6e-157 Click
93335771..3337312 PHAGE_Burkho_Bcep43: gp17; Ec53638_3394; phage(gi41057668) 1e-98 Click
103337272..3338042 PHAGE_Burkho_Bcep43: gp16; Ec53638_3395; phage(gi41057667) 7e-40 Click
113339390..3339872 PHAGE_Burkho_Bcep43: gp13; Ec53638_3397; phage(gi41057664) 1e-13 Click
123339872..3340900 PHAGE_Burkho_Bcep43: gp12; Ec53638_3398; phage(gi41057663) 5e-82 Click
133340904..3341251 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_3399; phage(gi422937543) 3e-12 Click
143341257..3341715 PHAGE_Burkho_Bcep43: gp08; Ec53638_3400; phage(gi41057658) 1e-20 Click
153341705..3342289 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_3401; phage(gi422937546) 3e-16 Click
163342286..3342651 PHAGE_Burkho_Bcep43: gp06; Ec53638_3402; phage(gi41057656) 2e-08 Click
173342636..3343181 PHAGE_Burkho_Bcep43: gp05; Ec53638_3403; phage(gi41057655) 3e-13 Click
183343162..3344646 PHAGE_Burkho_Bcep43: gp04; Ec53638_3404; phage(gi41057654) 1e-67 Click
193344647..3345093 PHAGE_Burkho_Bcep43: gp03; Ec53638_3405; phage(gi41057653) 7e-14 Click
203345093..3345497 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_3406; phage(gi422937551) 3e-22 Click
213345539..3345721 conserved hypothetical protein; Ec53638_3407 0.0 Click
223345705..3347726 PHAGE_Salmon_Vi06: predicted internal virion protein D; Ec53638_3408; phage(gi326633079) 2e-14 Click
233347723..3348433 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_3409; phage(gi422937557) 2e-06 Click
243348433..3348735 PHAGE_Burkho_Bcep43: gp49; Ec53638_3410; phage(gi41057702) 5e-09 Click
253348732..3349601 PHAGE_Burkho_Bcep43: gp38; Ec53638_3411; phage(gi41057690) 2e-10 Click
263349582..3350259 PHAGE_Burkho_Bcep43: gp36; Ec53638_3412; phage(gi41057688) 2e-19 Click
273350482..3350628 conserved hypothetical protein; Ec53638_3413 0.0 Click
283350625..3351866 PHAGE_Acinet_AP22: putative baseplate J-like protein; Ec53638_3414; phage(gi388570818) 5e-53 Click
293351868..3352473 PHAGE_Burkho_Bcep43: gp32; Ec53638_3415; phage(gi41057684) 3e-26 Click
303352460..3353692 PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_3416; phage(gi18249918) 8e-50 Click
313353695..3354240 PHAGE_Entero_phiP27: putative tail fiber assembly protein; Ec53638_3417; phage(gi18249919) 3e-75 Click
32complement(3354539..3355444) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; Ec53638_3418; phage(gi16130763) 5e-178 Click
33complement(3355402..3355767) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; Ec53638_3419; phage(gi17546153) 1e-45 Click
34complement(3355843..3356082) hypothetical protein; Ec53638_3420 0.0 Click
353356161..3356868 PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_3421; phage(gi18249920) 4e-18 Click
363356879..3357442 PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_3422; phage(gi18249921) 1e-80 Click

Region 11, total : 73 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13700803..3700814 attL    TTTGTGGATAAC 0.0 Click
23706096..3708723 PHAGE_Lactoc_949: putative DNA gyrase subunit A-topoisomerase; Ec53638_3763; phage(gi327197938) 1e-73 Click
33708872..3710560 conserved hypothetical protein; Ec53638_3764 0.0 Click
43710557..3711117 conserved hypothetical protein; Ec53638_3765 0.0 Click
5complement(3711175..3712248) PHAGE_Entero_mEp235: integrase; Ec53638_3766; phage(gi428781836) 0.0 Click
6complement(3712792..3713769) PHAGE_Cronob_phiES15: hypothetical protein; Ec53638_3767; phage(gi401817570) 5e-163 Click
7complement(3713845..3714735) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; Ec53638_3768; phage(gi157166067) 5e-173 Click
8complement(3714732..3715058) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; Ec53638_3769; phage(gi157166066) 3e-57 Click
9complement(3715208..3715504) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; Ec53638_3770; phage(gi116222045) 1e-43 Click
10complement(3715482..3717422) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; Ec53638_3771; phage(gi169257272) 2e-39 Click
11complement(3717446..3717742) PHAGE_Entero_HK225: hypothetical protein; Ec53638_3772; phage(gi428782411) 3e-10 Click
123719006..3719209 conserved hypothetical protein; Ec53638_3774 0.0 Click
13complement(3719260..3719388) hypothetical protein; Ec53638_3775 0.0 Click
143719818..3720120 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF22; Ec53638_3777; phage(gi157166007) 1e-18 Click
153720123..3720482 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF21; Ec53638_3778; phage(gi157166006) 8e-22 Click
16complement(3720529..3720921) PHAGE_Salmon_SPN3UB: putative CI; Ec53638_3779; phage(gi423262424) 6e-18 Click
173721036..3721320 PHAGE_Salmon_SPN3UB: putative Cro; Ec53638_3780; phage(gi423262425) 4e-23 Click
183721331..3721729 PHAGE_Pectob_ZF40: putative cII repressor; Ec53638_3781; phage(gi422936652) 5e-06 Click
193721740..3722471 hypothetical protein; Ec53638_3782 0.0 Click
203722507..3723514 PHAGE_Escher_TL_2011b: hypothetical protein; Ec53638_3783; phage(gi418487646) 1e-52 Click
213723303..3723968 PHAGE_Escher_HK639: replication protein 14; Ec53638_3784; phage(gi356870655) 2e-30 Click
223724003..3724515 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; Ec53638_3785; phage(gi116222030) 1e-09 Click
233724531..3724830 conserved hypothetical protein; Ec53638_3786 0.0 Click
243724856..3725182 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; Ec53638_3787; phage(gi157166066) 3e-57 Click
253725179..3726069 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; Ec53638_3788; phage(gi157166067) 5e-173 Click
263726115..3726270 LygF; Ec53638_3789 0.0 Click
273726297..3726572 PHAGE_Klebsi_phiKO2: Gp58; Ec53638_3790; phage(gi46402144) 1e-22 Click
283726559..3726879 PHAGE_Entero_ES18: gp41; Ec53638_3791; phage(gi62362254) 4e-30 Click
29complement(3726920..3727738) PROPHAGE_Escher_CFT073: transposase insF; Ec53638_3792; phage(gi26249410) 5e-159 Click
30complement(3727774..3728076) PROPHAGE_Xantho_33913: ISxac3 transposase; Ec53638_3793; phage(gi21231087) 9e-10 Click
313728443..3728559 conserved hypothetical protein; Ec53638_3794 0.0 Click
323728552..3728728 PHAGE_Shigel_AG3: hypothetical protein; Ec53638_3795; phage(gi282599330) 1e-13 Click
333728725..3729240 PHAGE_Salmon_ST64B: hypothetical protein sb32; Ec53638_3796; phage(gi23505476) 4e-11 Click
34complement(3729729..3729884) hypothetical bacteriophage protein; Ec53638_3797 0.0 Click
353729862..3730461 PHAGE_Entero_mEp237: hypothetical protein; Ec53638_3798; phage(gi435439315) 9e-54 Click
363730461..3730751 PHAGE_Erwini_phiEt88: hypothetical protein; Ec53638_3799; phage(gi327198620) 4e-34 Click
373730748..3731290 conserved hypothetical protein; Ec53638_3801 0.0 Click
38complement(3731270..3731395) hypothetical protein; Ec53638_3800 0.0 Click
393731498..3731574 tRNA 0.0 Click
403731576..3731652 tRNA 0.0 Click
413731655..3731730 tRNA 0.0 Click
423731734..3731808 tRNA 0.0 Click
43complement(3731819..3731932) hypothetical protein; Ec53638_3806 0.0 Click
443732097..3732312 PHAGE_Escher_P13374: lysis protein, holin; Ec53638_3807; phage(gi410491645) 1e-26 Click
453732312..3732809 PHAGE_Stx2_c_1717: phage-related lysozyme; Ec53638_3808; phage(gi209447172) 2e-93 Click
463732806..3733276 PHAGE_Entero_HK620: endopeptidase; Ec53638_3809; phage(gi13559860) 4e-76 Click
47complement(3733365..3733874) conserved hypothetical protein; Ec53638_3810 0.0 Click
483734072..3734836 PHAGE_Escher_TL_2011c: putative terminase small subunit; Ec53638_3812; phage(gi418487072) 3e-16 Click
493734787..3736190 PHAGE_Psychr_pOW20_A: phage terminase large subunit; Ec53638_3813; phage(gi472339822) 1e-157 Click
503736190..3737656 PHAGE_Aggreg_S1249: phage-related protein HI1409; Ec53638_3814; phage(gi273809569) 4e-44 Click
513737832..3738290 PHAGE_Aggreg_S1249: putative minor head protein; Ec53638_3815; phage(gi273809568) 1e-11 Click
523738294..3739514 PHAGE_Aggreg_S1249: hypothetical protein; Ec53638_3816; phage(gi273809565) 1e-19 Click
533739518..3740024 putative bacteriophage protein; Ec53638_3817 0.0 Click
543740036..3740977 PHAGE_Vibrio_CP_T1: putative major capsid protein; Ec53638_3818; phage(gi418489228) 4e-16 Click
553741019..3741240 hypothetical bacteriophage protein; Ec53638_3819 0.0 Click
563741206..3741613 PHAGE_Pseudo_KPP12: putative structural protein; Ec53638_3820; phage(gi431811107) 3e-09 Click
573741610..3742164 PHAGE_Psychr_pOW20_A: hypothetical protein; Ec53638_3821; phage(gi472339833) 2e-12 Click
583742151..3742540 putative bacteriophage protein; Ec53638_3822 0.0 Click
593742530..3743078 putative bacteriophage protein; Ec53638_3823 0.0 Click
603743082..3744227 PHAGE_Aggreg_S1249: hypothetical protein; Ec53638_3824; phage(gi273809558) 1e-43 Click
613744238..3744678 PHAGE_Pseudo_vB_PaeM_C2_10_Ab1: hypothetical protein; Ec53638_3825; phage(gi431809991) 4e-07 Click
623744682..3745134 putative bacteriophage protein; Ec53638_3826 0.0 Click
633745312..3747264 PHAGE_Aggreg_S1249: putative tail length tape measure protein; Ec53638_3827; phage(gi273809555) 7e-14 Click
643747465..3747914 putative bacteriophage protein; Ec53638_3828 0.0 Click
653747918..3748220 putative bacteriophage protein; Ec53638_3829 0.0 Click
663748554..3748919 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; Ec53638_3831; phage(gi17546153) 1e-45 Click
673748877..3749782 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; Ec53638_3832; phage(gi16130763) 5e-178 Click
683749829..3750599 PHAGE_Aggreg_S1249: hypothetical protein; Ec53638_3833; phage(gi273809551) 1e-13 Click
693751320..3752072 PHAGE_Aggreg_S1249: putative baseplate protein; Ec53638_3834; phage(gi273809550) 3e-28 Click
703752072..3752425 PHAGE_Aggreg_S1249: hypothetical protein; Ec53638_3835; phage(gi273809549) 9e-13 Click
713752425..3753624 PHAGE_Iodoba_phiPLPE: gp61 putative baseplate protein; Ec53638_3836; phage(gi197085675) 1e-42 Click
723753621..3754301 PHAGE_Aggreg_S1249: hypothetical protein; Ec53638_3837; phage(gi273809547) 8e-12 Click
733754301..3755557 PHAGE_Entero_Mu: tail fiber; Ec53638_3838; phage(gi9633540) 6e-63 Click
743755560..3756105 PHAGE_Entero_phiP27: putative tail fiber assembly protein; Ec53638_3839; phage(gi18249919) 7e-74 Click
753756129..3757397 PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_3840; phage(gi18249920) 5e-94 Click
763757408..3757971 PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_3841; phage(gi18249921) 4e-81 Click
77complement(3758151..3759188) invasion plasmid antigen; Ec53638_3842 0.0 Click
783760024..3760203 PROPHAGE_Escher_CFT073: transposase; Ec53638_3843; phage(gi26246249) 6e-06 Click
793763449..3763460 attR    TTTGTGGATAAC 0.0 Click

Region 12, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13905690..3906616 PHAGE_Plankt_PaV_LD: ABC transporter; Ec53638_3981; phage(gi371496158) 1e-24 Click
23906621..3907352 ABC transporter, quaternary amine uptake (QAT) family, permease protein; Ec53638_3982 0.0 Click
3complement(3907500..3908147) HTH-type transcriptional regulator MlrA; Ec53638_3983 0.0 Click
4complement(3909542..3909682) PHAGE_Entero_2008: putative excisionase; Ec53638_3985; phage(gi209427728) 8e-23 Click
5complement(3909815..3909949) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; Ec53638_3986; phage(gi157165988) 3e-22 Click
6complement(3909953..3910096) PHAGE_Entero_phiP27: hypothetical protein P27p03; Ec53638_3987; phage(gi18249867) 4e-13 Click
7complement(3910319..3910888) PHAGE_Salmon_1: hypothetical protein STM0896.2n.Fels1; Ec53638_3988; phage(gi169257162) 6e-25 Click
8complement(3910885..3911634) PHAGE_Entero_phiP27: hypothetical protein P27p14; Ec53638_3989; phage(gi18249878) 5e-55 Click
9complement(3911678..3912508) PHAGE_Entero_phiP27: putative serine protease; Ec53638_3990; phage(gi18249869) 6e-148 Click
10complement(3912536..3912649) hypothetical protein; Ec53638_3991 0.0 Click
11complement(3912754..3913146) PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; Ec53638_3992; phage(gi169257164) 3e-40 Click
12complement(3913333..3913548) PHAGE_Entero_phiP27: hypothetical protein P27p07; Ec53638_3993; phage(gi18249871) 9e-11 Click
13complement(3913548..3913907) PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; Ec53638_3994; phage(gi169257166) 2e-29 Click
14complement(3914103..3914309) PHAGE_Entero_phiP27: hypothetical protein P27p08; Ec53638_3995; phage(gi18249872) 9e-32 Click
15complement(3914651..3915145) PHAGE_Entero_phiP27: hypothetical protein P27p10; Ec53638_3996; phage(gi18249874) 6e-28 Click
16complement(3915292..3915981) PHAGE_Salmon_ST64B: regulatory protein; Ec53638_3997; phage(gi23505482) 1e-35 Click
173916115..3916381 PHAGE_Salmon_SPN3UB: putative Cro; Ec53638_3998; phage(gi423262425) 1e-13 Click
18complement(3916459..3916752) PHAGE_Burkho_Bcep176: gp17; Ec53638_3999; phage(gi77864642) 5e-06 Click
193916872..3917579 PHAGE_Entero_phiP27: hypothetical protein P27p14; Ec53638_4000; phage(gi18249878) 2e-118 Click
203917563..3918456 PHAGE_Entero_phiP27: hypothetical protein P27p15; Ec53638_4001; phage(gi18249879) 1e-159 Click
213918453..3919112 PHAGE_Entero_phiP27: hypothetical protein P27p16; Ec53638_4002; phage(gi18249880) 2e-110 Click
223919109..3919768 PHAGE_Entero_phiP27: hypothetical protein P27p16; Ec53638_4003; phage(gi18249880) 6e-102 Click
233919765..3920625 PHAGE_Entero_phiP27: hypothetical protein P27p16; Ec53638_4004; phage(gi18249880) 7e-31 Click
243920622..3920855 PHAGE_Entero_mEp460: hypothetical protein; Ec53638_4005; phage(gi428782358) 9e-16 Click
253920842..3921750 PHAGE_Entero_phiP27: hypothetical protein P27p17; Ec53638_4006; phage(gi18249881) 9e-74 Click
263921761..3922639 PHAGE_Entero_phiP27: putative replication protein DnaC; Ec53638_4007; phage(gi18249882) 8e-141 Click
273922636..3924027 PHAGE_Entero_phiP27: putative helicase; Ec53638_4008; phage(gi18249883) 0.0 Click
283924024..3924281 PHAGE_Entero_phiP27: hypothetical protein P27p20; Ec53638_4009; phage(gi18249884) 1e-36 Click
293924376..3924576 PHAGE_Escher_P13374: hypothetical protein; Ec53638_4010; phage(gi410491635) 2e-20 Click
303924569..3924949 PHAGE_Entero_2008: antitermination protein Q; Ec53638_4011; phage(gi209427762) 2e-62 Click
31complement(3924979..3925128) hypothetical protein; Ec53638_4012 0.0 Click
323925149..3925225 tRNA 0.0 Click
333925227..3925303 tRNA 0.0 Click
343925306..3925381 tRNA 0.0 Click
353925385..3925459 tRNA 0.0 Click
363925972..3926601 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; Ec53638_4018; phage(gi116221997) 2e-32 Click
373926667..3927200 PHAGE_Entero_mEp460: endolysin; Ec53638_4019; phage(gi428782372) 2e-101 Click
383927197..3927664 PHAGE_Entero_HK620: endopeptidase; Ec53638_4020; phage(gi13559860) 2e-79 Click
393927805..3928035 conserved hypothetical protein; Ec53638_4021 0.0 Click
403928010..3928339 conserved hypothetical protein; Ec53638_4022 0.0 Click
41complement(3928596..3929414) PROPHAGE_Escher_CFT073: transposase insF; Ec53638_4023; phage(gi26249410) 5e-159 Click
423929856..3930302 PHAGE_Entero_HK620: hypothetical protein HK620p38; Ec53638_4025; phage(gi13559861) 1e-85 Click
433930299..3930556 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp50; Ec53638_4026; phage(gi209447175) 2e-43 Click
44complement(3930633..3930809) hypothetical protein; Ec53638_4027 0.0 Click
453931206..3931715 PHAGE_Entero_N15: gp1; Ec53638_4029; phage(gi9630465) 2e-18 Click
463931687..3933069 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; Ec53638_4030; phage(gi169257235) 0.0 Click
473933423..3933800 PROPHAGE_Escher_MG1655: IS1 transposase B; Ec53638_4032; phage(gi16131317) 5e-70 Click
483933967..3934098 PHAGE_Entero_mEp460: host specificity protein; Ec53638_4033; phage(gi428782334) 3e-17 Click
493934168..3934767 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; Ec53638_4034; phage(gi209447197) 5e-111 Click
503934789..3936246 PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_4035; phage(gi18249920) 1e-74 Click
513936257..3936820 PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_4036; phage(gi18249921) 1e-80 Click
52complement(3937000..3937914) invasion plasmid antigen; Ec53638_4037 0.0 Click
533939684..3939953 PHAGE_Entero_HK630: tail fiber assembly protein; Ec53638_4038; phage(gi428782810) 8e-22 Click

Region 13, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3950721..3951833) PROPHAGE_Escher_MG1655: IS186 transposase; Ec53638_4049; phage(gi90111427) 0.0 Click
23952264..3953439 PROPHAGE_Shewan_MR-1: IS110 family transposase; Ec53638_4050; phage(gi24375433) 1e-09 Click
33953714..3954439 PHAGE_Entero_P4: DNA primase; Ec53638_4051; phage(gi9627512) 2e-44 Click
43954730..3954987 conserved hypothetical protein; Ec53638_4052 0.0 Click
53954984..3955406 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; Ec53638_4053; phage(gi56692915) 1e-09 Click
6complement(3955515..3955682) hypothetical protein; Ec53638_4054 0.0 Click
73955788..3956027 conserved hypothetical protein; Ec53638_4055 0.0 Click
83956027..3957082 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; Ec53638_4056; phage(gi169257230) 6e-83 Click
93957094..3957429 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; Ec53638_4057; phage(gi169257231) 2e-08 Click
103957442..3957855 conserved hypothetical protein; Ec53638_4058 0.0 Click
11complement(3957940..3958062) hypothetical protein; Ec53638_4059 0.0 Click
123958241..3958525 hypothetical bacteriophage protein; Ec53638_4060 0.0 Click
13complement(3959129..3959254) hypothetical protein; Ec53638_4061 0.0 Click
14complement(3959551..3960897) PROPHAGE_Escher_MG1655: IS4 transposase; Ec53638_4062; phage(gi16132099) 0.0 Click

Region 14, total : 99 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14192498..4192577 attL    CGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT 0.0 Click
2complement(4192892..4193782) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; Ec53638_4285; phage(gi157166067) 5e-173 Click
3complement(4193779..4194105) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; Ec53638_4286; phage(gi157166066) 3e-57 Click
4complement(4194835..4194975) PHAGE_Escher_P13374: prophage host toxic membrane protein; Ec53638_4287; phage(gi410491667) 1e-15 Click
54195487..4195636 hypothetical protein; Ec53638_4288 0.0 Click
6complement(4195920..4197608) PHAGE_Haemop_HP2: orf35; Ec53638_4289; phage(gi17981851) 7e-93 Click
7complement(4197592..4198158) PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_45; Ec53638_4290; phage(gi148727174) 7e-32 Click
8complement(4198121..4198864) PHAGE_Haemop_HP2: orf33; Ec53638_4291; phage(gi17981849) 8e-11 Click
9complement(4199001..4199528) PHAGE_Entero_Mu: tail fiber assembly; Ec53638_4292; phage(gi9633541) 1e-86 Click
10complement(4199530..4201536) PHAGE_Entero_Mu: tail fiber; Ec53638_4293; phage(gi9633540) 2e-70 Click
11complement(4201505..4202077) PHAGE_Haemop_HP2: orf30; Ec53638_4294; phage(gi17981846) 6e-46 Click
12complement(4202070..4203248) PHAGE_Haemop_HP2: orf29; Ec53638_4295; phage(gi17981845) 5e-108 Click
13complement(4203238..4203576) PHAGE_Pasteu_F108: hypothetical protein F108p34; Ec53638_4296; phage(gi109302930) 2e-30 Click
14complement(4203580..4205661) PHAGE_Vibrio_kappa: putative tail length determinator; Ec53638_4297; phage(gi165970271) 3e-103 Click
15complement(4205849..4206121) PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_36; Ec53638_4298; phage(gi148727164) 2e-19 Click
16complement(4206152..4206616) PHAGE_Entero_HK106: lysis protein Rz; Ec53638_4299; phage(gi428783342) 2e-25 Click
17complement(4206623..4207066) PHAGE_Entero_ES18: gp76; Ec53638_4300; phage(gi62362289) 1e-48 Click
18complement(4207063..4207401) PHAGE_Entero_SfV: holin; Ec53638_4301; phage(gi19549036) 5e-14 Click
19complement(4207410..4207871) PHAGE_Aeromo_phiO18P: putative tail tube protein; Ec53638_4302; phage(gi148727159) 7e-41 Click
20complement(4207875..4208999) PHAGE_Haemop_HP2: tail sheath; Ec53638_4303; phage(gi17981837) 5e-89 Click
21complement(4209003..4209731) PHAGE_Aeromo_phiO18P: putative tail completion protein; Ec53638_4304; phage(gi148727157) 1e-23 Click
22complement(4209735..4210214) PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_27; Ec53638_4305; phage(gi148727156) 1e-14 Click
23complement(4210211..4210681) PHAGE_Aeromo_phiO18P: putative head completion protein; Ec53638_4306; phage(gi148727155) 5e-24 Click
24complement(4211058..4211621) putative repressor protein CI; Ec53638_4307 0.0 Click
254211786..4212037 PHAGE_Entero_Mu: DNA binding protein ner; Ec53638_4308; phage(gi9633495) 9e-05 Click
264212039..4214144 PROPHAGE_Escher_Sakai: phage transposase; Ec53638_4309; phage(gi15834199) 0.0 Click
274214179..4215132 PHAGE_Entero_Mu: DNA transposition protein; Ec53638_4310; phage(gi9633513) 7e-130 Click
284215129..4215356 PHAGE_Entero_Mu: kil; Ec53638_4311; phage(gi9633497) 3e-37 Click
294215359..4215589 PHAGE_Entero_Mu: hypothetical protein Mup06; Ec53638_4312; phage(gi9633498) 2e-31 Click
304215601..4215864 PHAGE_Entero_Mu: hypothetical protein Mup07; Ec53638_4313; phage(gi9633499) 7e-37 Click
314215879..4216298 PHAGE_Entero_Mu: hypothetical protein Mup08; Ec53638_4314; phage(gi9633547) 4e-72 Click
324216311..4216598 PHAGE_Entero_Mu: hypothetical protein Mup09; Ec53638_4315; phage(gi9633546) 1e-42 Click
334216617..4217141 PHAGE_Entero_Mu: Gam; Ec53638_4316; phage(gi9633500) 1e-86 Click
344217234..4217788 hypothetical protein; Ec53638_4317 0.0 Click
354217792..4218322 PHAGE_Entero_Mu: hypothetical protein Mup11; Ec53638_4318; phage(gi9633501) 1e-94 Click
364218322..4218852 PHAGE_Entero_Mu: hypothetical protein Mup12; Ec53638_4319; phage(gi9633502) 7e-97 Click
374218839..4219021 PHAGE_Entero_Mu: hypothetical protein Mup13; Ec53638_4320; phage(gi9633503) 2e-33 Click
384219023..4219331 conserved hypothetical protein; Ec53638_4321 0.0 Click
394219328..4219630 PHAGE_Entero_Mu: hypothetical protein Mup14; Ec53638_4322; phage(gi9633504) 5e-50 Click
404219905..4220456 PHAGE_Entero_Mu: hypothetical protein Mup16; Ec53638_4323; phage(gi9633506) 7e-101 Click
414220453..4220842 PHAGE_Entero_Mu: Mor; Ec53638_4324; phage(gi9633507) 6e-70 Click
424220920..4221150 PHAGE_Entero_Mu: hypothetical protein Mup18; Ec53638_4325; phage(gi9633508) 4e-37 Click
434221131..4221250 PHAGE_Entero_Mu: hypothetical protein Mup20; Ec53638_4326; phage(gi9633510) 2e-14 Click
444221263..4221685 PHAGE_Entero_Mu: putative transcription regulator; Ec53638_4327; phage(gi9633511) 2e-78 Click
454221780..4222295 PHAGE_Entero_Mu: Lys; Ec53638_4328; phage(gi9633512) 9e-96 Click
464222279..4222665 PHAGE_Entero_Mu: hypothetical protein Mup23; Ec53638_4329; phage(gi9633514) 1e-66 Click
474222824..4223018 PHAGE_Entero_Mu: hypothetical protein Mup24; Ec53638_4330; phage(gi9633515) 2e-34 Click
484223018..4223317 PHAGE_Entero_Mu: hypothetical protein Mup25; Ec53638_4331; phage(gi9633516) 3e-49 Click
494223314..4223604 PHAGE_Entero_Mu: hypothetical protein Mup26; Ec53638_4332; phage(gi9633517) 7e-50 Click
504223616..4224191 PHAGE_Entero_Mu: hypothetical protein Mup27; Ec53638_4333; phage(gi9633518) 7e-101 Click
514224466..4226121 PHAGE_Entero_Mu: putative portal protein; Ec53638_4334; phage(gi9633519) 0.0 Click
524226121..4227659 PHAGE_Entero_Mu: hypothetical protein Mup29; Ec53638_4335; phage(gi9633520) 0.0 Click
534227640..4228959 PHAGE_Entero_Mu: virion morphogenesis late F orf; Ec53638_4336; phage(gi9633521) 0.0 Click
544228956..4229426 PHAGE_Entero_Mu: putative virion morphogenesis protein; Ec53638_4337; phage(gi9633522) 3e-87 Click
554229623..4230708 PHAGE_Entero_Mu: putative protease protein; Ec53638_4338; phage(gi9633523) 0.0 Click
564230705..4231622 PHAGE_Entero_Mu: major head subunit; Ec53638_4339; phage(gi9633525) 1e-177 Click
574231689..4232099 PHAGE_Entero_Mu: hypothetical protein Mup35; Ec53638_4340; phage(gi9633526) 4e-68 Click
584232096..4232521 PHAGE_Entero_Mu: hypothetical protein Mup36; Ec53638_4341; phage(gi9633527) 2e-75 Click
594232521..4233069 PHAGE_Entero_Mu: hypothetical protein Mup37; Ec53638_4342; phage(gi9633528) 4e-104 Click
604233056..4233259 PHAGE_Entero_Mu: hypothetical protein Mup38; Ec53638_4343; phage(gi9633529) 1e-31 Click
614233256..4234743 PHAGE_Entero_Mu: major tail subunit; Ec53638_4344; phage(gi9633530) 0.0 Click
624234753..4235109 PHAGE_Entero_Mu: hypothetical protein Mup40; Ec53638_4345; phage(gi9633531) 2e-61 Click
634235119..4235553 PHAGE_Entero_Mu: hypothetical protein Mup41; Ec53638_4346; phage(gi9633532) 7e-68 Click
644235698..4237770 PHAGE_Entero_Mu: putative tape measure protein; Ec53638_4347; phage(gi9633533) 0.0 Click
654239255..4240388 PHAGE_Entero_Mu: putative tail protein; Ec53638_4349; phage(gi9633535) 0.0 Click
664240376..4240969 PHAGE_Entero_Mu: putative baseplate assembly protein; Ec53638_4350; phage(gi9633536) 2e-104 Click
674240966..4241403 PHAGE_Entero_Mu: hypothetical protein Mup46; Ec53638_4351; phage(gi9633537) 9e-82 Click
684241404..4242486 PHAGE_Entero_Mu: hypothetical protein Mup47; Ec53638_4352; phage(gi9633538) 0.0 Click
694242477..4243019 PHAGE_Entero_Mu: hypothetical protein Mup48; Ec53638_4353; phage(gi9633539) 6e-102 Click
704243019..4244530 PHAGE_Entero_Mu: tail fiber; Ec53638_4354; phage(gi9633540) 0.0 Click
714244534..4245061 PHAGE_Entero_Mu: tail fiber assembly; Ec53638_4355; phage(gi9633541) 3e-93 Click
72complement(4245090..4245623) PHAGE_Entero_Mu: tail fiber assembly protein; Ec53638_4356; phage(gi19584573) 2e-98 Click
73complement(4245626..4246063) PHAGE_Entero_Mu: tail fiber fragment; Ec53638_4357; phage(gi19584574) 4e-76 Click
744246300..4247025 PHAGE_Entero_Mu: Mom; Ec53638_4358; phage(gi9633544) 1e-138 Click
75complement(4247158..4247859) PHAGE_Aeromo_phiO18P: putative terminase small subunit; Ec53638_4359; phage(gi148727154) 2e-48 Click
76complement(4247871..4248920) PHAGE_Aeromo_phiO18P: putative major capsid protein; Ec53638_4360; phage(gi148727153) 2e-71 Click
77complement(4248969..4250141) PHAGE_Aeromo_phiO18P: putative capsid scaffolding protein; Ec53638_4361; phage(gi148727152) 3e-27 Click
784250239..4252062 PHAGE_Vibrio_kappa: putative terminase ATPase subunit; Ec53638_4362; phage(gi165970256) 8e-159 Click
794252059..4253114 PHAGE_Aeromo_phiO18P: putative portal protein; Ec53638_4363; phage(gi148727149) 8e-88 Click
804253165..4253440 PHAGE_Vibrio_kappa: hypothetical zinc-finger protein; Ec53638_4364; phage(gi165970253) 4e-06 Click
81complement(4253496..4253744) hypothetical protein; Ec53638_4365 0.0 Click
82complement(4253741..4254046) hypothetical protein; Ec53638_4366 0.0 Click
83complement(4254169..4256661) PHAGE_Entero_2: P2 gpA-like protein; Ec53638_4367; phage(gi169936054) 7e-163 Click
84complement(4256658..4257047) hypothetical protein; Ec53638_4368 0.0 Click
85complement(4257120..4257350) conserved domain protein; Ec53638_4369 0.0 Click
86complement(4257671..4258225) conserved hypothetical protein; Ec53638_4370 0.0 Click
87complement(4258216..4258527) PHAGE_Entero_N15: gp57; Ec53638_4371; phage(gi9630522) 1e-22 Click
88complement(4258524..4259486) PHAGE_Entero_P1: Dmt; Ec53638_4372; phage(gi46401691) 4e-53 Click
89complement(4259483..4259722) hypothetical protein; Ec53638_4374 0.0 Click
90complement(4259719..4260249) hypothetical protein; Ec53638_4375 0.0 Click
91complement(4260491..4260913) hypothetical protein; Ec53638_4376 0.0 Click
924261030..4261185 hypothetical protein; Ec53638_4377 0.0 Click
93complement(4261202..4261444) hypothetical protein; Ec53638_4378 0.0 Click
94complement(4261486..4261836) conserved hypothetical protein; Ec53638_4379 0.0 Click
95complement(4261865..4262059) hypothetical protein; Ec53638_4380 0.0 Click
96complement(4262557..4262763) PHAGE_Burkho_phiE202: gp20, conserved hypothetical protein; Ec53638_4381; phage(gi134288764) 9e-05 Click
974263045..4263218 hypothetical protein; Ec53638_4382 0.0 Click
984263240..4263914 conserved hypothetical protein; Ec53638_4383 0.0 Click
994264091..4264261 conserved hypothetical protein; Ec53638_4384 0.0 Click
1004264272..4265297 PHAGE_Haemop_HP2: integrase; Ec53638_4385; phage(gi17981816) 1e-110 Click
1014265416..4265495 attR    CGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT 0.0 Click

Region 15, total : 65 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4303022..4303765) PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; Ec53638_4426; phage(gi333798309) 1e-24 Click
2complement(4303806..4304201) conserved hypothetical protein; Ec53638_4427 0.0 Click
3complement(4304254..4304979) protein of unknown function; Ec53638_4428 0.0 Click
44304812..4304823 attL    GCGGGTCAAAAA 0.0 Click
5complement(4305006..4306319) PHAGE_Entero_phiP27: putative integrase; Ec53638_4429; phage(gi18249865) 0.0 Click
64306364..4306480 hypothetical protein; Ec53638_4430 0.0 Click
7complement(4306620..4306766) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; Ec53638_4431; phage(gi157165988) 3e-22 Click
8complement(4306770..4306913) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; Ec53638_4432; phage(gi157165989) 6e-15 Click
9complement(4307136..4307705) PHAGE_Salmon_1: hypothetical protein STM0896.2n.Fels1; Ec53638_4433; phage(gi169257162) 6e-25 Click
10complement(4307702..4308451) PHAGE_Entero_phiP27: hypothetical protein P27p14; Ec53638_4434; phage(gi18249878) 5e-55 Click
11complement(4308495..4309325) PHAGE_Entero_phiP27: putative serine protease; Ec53638_4435; phage(gi18249869) 6e-148 Click
12complement(4309353..4309466) hypothetical protein; Ec53638_4436 0.0 Click
13complement(4309555..4310373) PROPHAGE_Escher_CFT073: transposase insF; Ec53638_4437; phage(gi26249410) 5e-159 Click
14complement(4310409..4310711) PROPHAGE_Xantho_33913: ISxac3 transposase; Ec53638_4438; phage(gi21231087) 9e-10 Click
15complement(4310838..4311230) PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; Ec53638_4439; phage(gi169257164) 2e-40 Click
16complement(4311417..4311632) PHAGE_Entero_phiP27: hypothetical protein P27p07; Ec53638_4440; phage(gi18249871) 9e-11 Click
17complement(4311632..4311991) PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; Ec53638_4441; phage(gi169257166) 9e-29 Click
18complement(4311995..4312108) hypothetical protein; Ec53638_4442 0.0 Click
19complement(4312665..4313168) PHAGE_Entero_phiP27: hypothetical protein P27p10; Ec53638_4444; phage(gi18249874) 3e-67 Click
20complement(4313265..4313921) PHAGE_Entero_phiP27: putative lambda repressor; Ec53638_4445; phage(gi18249875) 1e-125 Click
21complement(4314051..4314182) hypothetical protein; Ec53638_4446 0.0 Click
22complement(4314313..4314606) PHAGE_Burkho_Bcep176: gp17; Ec53638_4447; phage(gi77864642) 6e-07 Click
234314726..4315433 PHAGE_Entero_phiP27: hypothetical protein P27p14; Ec53638_4448; phage(gi18249878) 1e-102 Click
244315453..4315629 conserved hypothetical protein; Ec53638_4449 0.0 Click
25complement(4315651..4316010) conserved hypothetical protein; Ec53638_4450 0.0 Click
26complement(4316012..4316299) conserved hypothetical protein; Ec53638_4451 0.0 Click
274316264..4317382 PHAGE_Entero_mEp460: regulatory protein Rha; Ec53638_4452; phage(gi428782357) 4e-22 Click
284317379..4318239 PHAGE_Entero_mEp460: regulatory protein Rha; Ec53638_4453; phage(gi428782357) 3e-104 Click
294318236..4318430 hypothetical protein; Ec53638_4454 0.0 Click
304318427..4318651 PHAGE_Entero_mEp460: hypothetical protein; Ec53638_4455; phage(gi428782358) 2e-18 Click
314318648..4319559 PHAGE_Entero_mEp460: replication protein; Ec53638_4456; phage(gi428782359) 3e-49 Click
324319556..4320464 PHAGE_Entero_phiP27: putative replication protein DnaC; Ec53638_4457; phage(gi18249882) 1e-84 Click
334320461..4321861 PHAGE_Entero_phiP27: putative helicase; Ec53638_4458; phage(gi18249883) 0.0 Click
344321858..4322115 PHAGE_Entero_phiP27: hypothetical protein P27p20; Ec53638_4459; phage(gi18249884) 4e-37 Click
354322115..4322486 PHAGE_Entero_phiP27: putative antitermination protein Q; Ec53638_4460; phage(gi18249885) 4e-37 Click
364322845..4322985 hypothetical protein; Ec53638_4461 0.0 Click
374323250..4323387 hypothetical protein; Ec53638_4462 0.0 Click
38complement(4323590..4323727) hypothetical protein; Ec53638_4463 0.0 Click
394324909..4324984 tRNA 0.0 Click
404324986..4325062 tRNA 0.0 Click
414325065..4325140 tRNA 0.0 Click
424325144..4325218 tRNA 0.0 Click
434325909..4326115 PHAGE_Entero_mEp460: porin; Ec53638_4469; phage(gi428782370) 2e-29 Click
444326120..4326650 PHAGE_Entero_mEp460: hypothetical protein; Ec53638_4470; phage(gi428782371) 4e-37 Click
454326972..4327505 PHAGE_Entero_mEp460: endolysin; Ec53638_4471; phage(gi428782372) 1e-98 Click
464327502..4327969 PHAGE_Entero_mEp460: Rz lysis protein; Ec53638_4472; phage(gi428782373) 7e-73 Click
474328011..4328322 PHAGE_Klebsi_phiKO2: Gp58; Ec53638_4473; phage(gi46402144) 3e-47 Click
484328908..4329417 PHAGE_Entero_N15: gp1; Ec53638_4475; phage(gi9630465) 2e-18 Click
494329389..4331317 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; Ec53638_4476; phage(gi169257235) 0.0 Click
504331301..4331504 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; Ec53638_4477; phage(gi169257234) 8e-14 Click
514331501..4333093 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; Ec53638_4478; phage(gi169257233) 0.0 Click
524333083..4334588 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; Ec53638_4479; phage(gi169257232) 3e-175 Click
534334625..4334972 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; Ec53638_4480; phage(gi169257231) 1e-42 Click
544335030..4336058 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; Ec53638_4481; phage(gi169257230) 1e-172 Click
554336110..4336496 PHAGE_Entero_HK630: DNA packaging protein Fi; Ec53638_4482; phage(gi428782796) 8e-20 Click
564336508..4336885 PHAGE_Entero_HK630: head-tail connector Fii; Ec53638_4483; phage(gi428782797) 6e-33 Click
574336872..4337456 PHAGE_Entero_mEp460: minor tail protein; Ec53638_4484; phage(gi428782324) 2e-92 Click
584337453..4337854 PHAGE_Entero_mEp460: minor tail protein; Ec53638_4485; phage(gi428782325) 5e-73 Click
594337865..4338605 PHAGE_Entero_mEp460: major tail protein; Ec53638_4486; phage(gi428782326) 1e-133 Click
604338664..4339050 PHAGE_Entero_mEp460: minor tail protein; Ec53638_4487; phage(gi428782327) 4e-63 Click
614339071..4339388 PHAGE_Entero_mEp460: tail assembly protein; Ec53638_4488; phage(gi428782328) 1e-56 Click
624339360..4342401 PHAGE_Entero_mEp460: tail length tape measure protein; Ec53638_4489; phage(gi428782329) 0.0 Click
634342401..4342730 PHAGE_Entero_mEp460: minor tail protein; Ec53638_4490; phage(gi428782330) 2e-59 Click
644342740..4343438 PHAGE_Entero_mEp460: minor tail protein; Ec53638_4491; phage(gi428782331) 5e-126 Click
654343587..4344186 PHAGE_Entero_mEp460: tail fiber component; Ec53638_4492; phage(gi428782332) 2e-115 Click
664344183..4344725 PHAGE_Entero_mEp460: tail assembly protein; Ec53638_4493; phage(gi428782333) 1e-80 Click
674344786..4348283 PHAGE_Entero_mEp460: host specificity protein; Ec53638_4494; phage(gi428782334) 0.0 Click
684348353..4348952 PHAGE_Entero_mEp460: Lom protein; Ec53638_4495; phage(gi428782335) 8e-109 Click
694348974..4350431 PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_4496; phage(gi18249920) 7e-74 Click
704350442..4351008 PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_4497; phage(gi18249921) 2e-81 Click
714351984..4351995 attR    GCGGGTCAAAAA 0.0 Click

Region 16, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5056750..5057406) PHAGE_Entero_HK446: NinI protein; Ec53638_5184; phage(gi428782246) 1e-53 Click
2complement(5057507..5057656) hypothetical protein; Ec53638_5185 0.0 Click
35058157..5059863 PHAGE_Ostreo_OlV1: hypothetical protein; Ec53638_5186; phage(gi313843974) 1e-07 Click
4complement(5060043..5060606) PHAGE_Entero_phiP27: hypothetical protein P27p57; Ec53638_5187; phage(gi18249921) 6e-79 Click
5complement(5060617..5061885) PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_5188; phage(gi18249920) 3e-94 Click
6complement(5061909..5062454) PHAGE_Entero_phiP27: putative tail fiber assembly protein; Ec53638_5189; phage(gi18249919) 7e-74 Click
7complement(5062457..5063689) PHAGE_Entero_phiP27: putative tail fiber protein; Ec53638_5190; phage(gi18249918) 8e-50 Click
8complement(5063676..5064281) PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_5191; phage(gi422937564) 7e-33 Click
9complement(5064283..5065524) PHAGE_Acinet_AP22: putative baseplate J-like protein; Ec53638_5192; phage(gi388570818) 5e-53 Click
10complement(5065521..5065667) conserved hypothetical protein; Ec53638_5193 0.0 Click
11complement(5065890..5066567) PHAGE_Aeromo_vB_AsaM_56: putative baseplate protein; Ec53638_5194; phage(gi422937560) 6e-25 Click
12complement(5066548..5066853) PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; Ec53638_5195; phage(gi422937559) 7e-08 Click
135066931..5067041 hypothetical protein; Ec53638_A0001 0.0 Click
14complement(5067640..5068194) PHAGE_Cronob_phiES15: terminase small subunit; Ec53638_A0002; phage(gi401817591) 5e-48 Click
155068297..5068623 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; Ec53638_A0003; phage(gi157166066) 3e-57 Click
165068620..5069510 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; Ec53638_A0004; phage(gi157166067) 5e-173 Click
17complement(5069631..5069768) hypothetical protein; Ec53638_A0005 0.0 Click
185070426..5070752 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; Ec53638_A0007; phage(gi157166066) 3e-57 Click
195070749..5071018 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; Ec53638_A0008; phage(gi157166067) 6e-50 Click