Escherichia coli E22 , whole genome shotgun [asmbl_id: NC_000000].5528238, GC%: 50.62%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1584311..584322 attL    GCTACCAGGCTG 0.0 Click
2593545..593907 PHAGE_Entero_mEp460: hypothetical protein; EcE22_3319; phage(gi428782351) 3e-63 Click
3594920..595456 PHAGE_Entero_mEp460: hypothetical protein; EcE22_3322; phage(gi428782349) 3e-99 Click
4595468..595809 PHAGE_Entero_mEp460: hypothetical protein; EcE22_3323; phage(gi428782348) 1e-64 Click
5595806..596009 PHAGE_Entero_mEp460: hypothetical protein; EcE22_3324; phage(gi428782347) 9e-34 Click
6596002..596241 PHAGE_Entero_mEp460: hypothetical protein; EcE22_3325; phage(gi428782346) 7e-37 Click
7596238..596837 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; EcE22_3326; phage(gi89152464) 2e-78 Click
8596839..597354 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp06; EcE22_3327; phage(gi209447131) 1e-100 Click
9597351..598217 PHAGE_Escher_P13374: hypothetical protein; EcE22_3328; phage(gi410491607) 5e-132 Click
10complement(598349..598510) hypothetical protein; EcE22_3329 0.0 Click
11598547..598681 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; EcE22_3330; phage(gi157165988) 5e-20 Click
12598700..598954 PHAGE_Entero_2008: putative excisionase; EcE22_3331; phage(gi209427728) 2e-45 Click
13598988..600274 PROPHAGE_Escher_Sakai: putative integrase; EcE22_3332; phage(gi15832267) 0.0 Click
14600349..600996 conserved hypothetical protein; EcE22_3333 0.0 Click
15complement(601144..601875) ABC transporter, quaternary amine uptake (QAT) family, permease protein; EcE22_3334 0.0 Click
16complement(601880..602806) PHAGE_Plankt_PaV_LD: ABC transporter; EcE22_3335; phage(gi371496158) 6e-25 Click
17complement(602799..603956) PHAGE_Lactob_KC5a: putative minor tail protein; EcE22_3336; phage(gi90592623) 9e-05 Click
18612005..612016 attR    GCTACCAGGCTG 0.0 Click

Region 2, total : 41 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1883743..884102 PHAGE_Escher_HK75: RusA-like protein; EcE22_4678; phage(gi356870726) 6e-38 Click
2884111..884665 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; EcE22_4679; phage(gi399528832) 1e-06 Click
3884892..885089 PHAGE_Entero_phiP27: hypothetical protein P27p23; EcE22_4680; phage(gi18249887) 2e-31 Click
4885240..886286 PHAGE_Entero_phiP27: putative DNA methylase; EcE22_4681; phage(gi18249888) 0.0 Click
5886427..886503 tRNA 0.0 Click
6886505..886581 tRNA 0.0 Click
7886583..886660 tRNA 0.0 Click
8886663..886737 tRNA 0.0 Click
9887812..887964 PHAGE_Entero_P1: TciB; EcE22_4687; phage(gi46401695) 2e-06 Click
10888054..888446 PHAGE_Entero_phiP27: putative holin; EcE22_4688; phage(gi18249892) 1e-65 Click
11888436..888711 PHAGE_Entero_phiP27: putative holin; EcE22_4689; phage(gi18249893) 4e-47 Click
12888714..889091 PHAGE_Entero_phiP27: putative endolysin; EcE22_4690; phage(gi18249894) 8e-67 Click
13889133..889288 hypothetical protein; EcE22_4691 0.0 Click
14890018..890203 hypothetical protein; EcE22_4693 0.0 Click
15complement(890279..890410) hypothetical protein; EcE22_4694 0.0 Click
16890443..890991 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; EcE22_4695; phage(gi169257236) 4e-67 Click
17890963..892879 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; EcE22_4696; phage(gi169257235) 0.0 Click
18892883..893092 PHAGE_Entero_mEp237: head-tail connector; EcE22_4697; phage(gi435439268) 1e-12 Click
19893089..894660 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; EcE22_4698; phage(gi169257233) 0.0 Click
20894650..896266 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; EcE22_4699; phage(gi169257232) 5e-167 Click
21896305..896640 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; EcE22_4700; phage(gi169257231) 1e-42 Click
22896710..897738 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; EcE22_4701; phage(gi169257230) 1e-166 Click
23897789..898154 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; EcE22_4702; phage(gi169257229) 2e-13 Click
24898157..898558 PHAGE_Gifsy_1: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; EcE22_4703; phage(gi169257228) 2e-07 Click
25898539..899261 hypothetical protein; EcE22_4704 0.0 Click
26899261..899824 conserved hypothetical protein; EcE22_4705 0.0 Click
27899808..900431 PHAGE_Erwini_ENT90: baseplate assembly protein; EcE22_4706; phage(gi431810950) 3e-14 Click
28900466..900822 PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; EcE22_4707; phage(gi428782737) 7e-21 Click
29900797..901711 PHAGE_Salmon_RE_2010: baseplate assembly protein J; EcE22_4708; phage(gi418489711) 7e-52 Click
30901704..902294 PHAGE_Salmon_RE_2010: tail protein I; EcE22_4709; phage(gi418489712) 3e-19 Click
31902291..903676 PHAGE_Entero_phiP27: putative tail fiber protein; EcE22_4710; phage(gi18249918) 2e-123 Click
32903679..904224 PHAGE_Entero_phiP27: putative tail fiber assembly protein; EcE22_4711; phage(gi18249919) 5e-96 Click
33904279..905754 PROPHAGE_Xylell_Temecula1: contractile tail sheath protein; EcE22_4712; phage(gi28198986) 6e-65 Click
34905751..906269 PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; EcE22_4713; phage(gi428782747) 5e-13 Click
35906329..906631 conserved hypothetical protein; EcE22_4714 0.0 Click
36906749..908401 PHAGE_Entero_mEpX2: tail length tape measure protein; EcE22_4715; phage(gi428765628) 3e-09 Click
37908404..908892 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; EcE22_4716; phage(gi428782751) 2e-16 Click
38908867..909085 PHAGE_Ralsto_phiRSA1: phage tail X; EcE22_4717; phage(gi145708085) 1e-11 Click
39909076..910164 PROPHAGE_Xylell_Temecula1: phage-related tail protein; EcE22_4718; phage(gi28198980) 1e-27 Click
40910334..910447 hypothetical protein; EcE22_4719 0.0 Click
41910492..913329 PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; EcE22_4720; phage(gi169257214) 1e-53 Click
42913343..913921 PHAGE_Entero_phiP27: hypothetical protein P27p57; EcE22_4721; phage(gi18249921) 2e-79 Click
43complement(913988..914500) PHAGE_Escher_TL_2011b: hypothetical protein; EcE22_4722; phage(gi418487682) 1e-39 Click
44complement(914546..915058) PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; EcE22_4723; phage(gi418487638) 3e-61 Click
45complement(915438..915998) PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; EcE22_4724; phage(gi169257243) 3e-47 Click

Region 3, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11010645..1010658 attL    TGATGTTGCTGCGC 0.0 Click
2complement(1012241..1013476) PHAGE_Gifsy_2: bacteriophage integrase; integrase;; phage EcE22_4823(gi169257268) 2e-89 Click
3complement(1013478..1013693) conserved hypothetical protein; EcE22_4824 0.0 Click
4complement(1013793..1013981) conserved hypothetical protein; EcE22_4825 0.0 Click
5complement(1014232..1015284) PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; EcE22_4826; phage(gi169257271) 1e-84 Click
6complement(1015296..1018367) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; EcE22_4827; phage(gi169257272) 0.0 Click
7complement(1018818..1018994) PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; EcE22_4829; phage(gi169257274) 1e-05 Click
8complement(1018988..1019209) PHAGE_Escher_P13374: host killing protein; EcE22_4830; phage(gi410491620) 2e-06 Click
91019700..1020128 superinfection exclusion protein B; EcE22_4831 0.0 Click
10complement(1020291..1020425) conserved hypothetical protein; EcE22_4832 0.0 Click
111021652..1022074 PHAGE_Entero_mEp237: CII protein; EcE22_4833; phage(gi435439306) 7e-09 Click
121022087..1022944 PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; EcE22_4834; phage(gi169257279) 9e-23 Click
131022951..1023697 PHAGE_Gifsy_2: bacteriophage DNA replication protein; EcE22_4835; phage(gi169257280) 3e-75 Click
141023720..1024481 conserved hypothetical protein; EcE22_4836 0.0 Click
151024497..1024901 conserved hypothetical protein; EcE22_4837 0.0 Click
161024926..1025228 PHAGE_Escher_P13374: hypothetical protein; EcE22_4838; phage(gi410491609) 4e-07 Click
171025230..1025586 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; EcE22_4839; phage(gi20065868) 3e-08 Click
181025813..1026205 PHAGE_Stx2_c_86: antitermination protein Q; EcE22_4841; phage(gi116222072) 2e-18 Click
191032920..1032933 attR    TGATGTTGCTGCGC 0.0 Click

Region 4, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11029320..1029919 PHAGE_Entero_mEp237: hypothetical protein; EcE22_4845; phage(gi435439315) 1e-53 Click
21029919..1030209 PHAGE_Erwini_phiEt88: hypothetical protein; EcE22_4846; phage(gi327198620) 8e-33 Click
31030206..1030748 putative bacteriophage protein; EcE22_4847 0.0 Click
41031101..1031178 tRNA 0.0 Click
51031181..1031255 tRNA 0.0 Click
6complement(1031877..1032002) hypothetical protein; EcE22_4850 0.0 Click
71032035..1032250 PHAGE_Entero_cdtI: lysis protein; EcE22_4851; phage(gi148609439) 5e-35 Click
81032250..1032747 PHAGE_Entero_cdtI: lysin; EcE22_4852; phage(gi148609440) 5e-92 Click
91032744..1033208 PHAGE_Entero_cdtI: lysin; EcE22_4853; phage(gi148609441) 9e-60 Click
101033346..1034803 Rac prophage; potassium transporter subunit; EcE22_4854 0.0 Click
111034941..1035729 PHAGE_Lactob_c5: putative ParB nuclease; EcE22_4855; phage(gi418488153) 2e-49 Click
121035722..1036654 PHAGE_Lactob_c5: hypothetical protein; EcE22_4856; phage(gi418488154) 2e-51 Click
131036632..1036841 conserved hypothetical protein; EcE22_4857 0.0 Click
141036845..1037939 PHAGE_Burkho_BcepMigl: terminase small subunit; EcE22_4858; phage(gi431809885) 2e-29 Click
151037920..1039221 PHAGE_Pseudo_H105/1: phage terminase large subunit; EcE22_4859; phage(gi327198525) 1e-111 Click
161039224..1040630 PHAGE_Escher_HK639: hypothetical protein; EcE22_4860; phage(gi356870603) 0.0 Click
171040614..1041726 PHAGE_Pseudo_MP1412: head morphogenesis/minor structural protein; EcE22_4861; phage(gi399529016) 2e-56 Click
181041831..1042595 PHAGE_Escher_HK639: hypothetical protein; EcE22_4862; phage(gi356870605) 4e-91 Click
191042694..1043833 PHAGE_Vibrio_vB_VpaS_MAR10: major capsid protein; EcE22_4863; phage(gi428782119) 5e-35 Click
201043876..1044052 PHAGE_Escher_HK639: hypothetical protein; EcE22_4864; phage(gi356870607) 4e-14 Click
211044056..1044451 conserved hypothetical protein; EcE22_4865 0.0 Click
221044448..1044834 PHAGE_Acinet_Bphi_B1251: hypothetical protein; EcE22_4866; phage(gi423262010) 8e-17 Click
231044835..1045215 PHAGE_Salmon_SE2: hypothetical protein; EcE22_4867; phage(gi375267267) 6e-14 Click
241045212..1045604 PHAGE_Acinet_Bphi_B1251: hypothetical protein; EcE22_4868; phage(gi423262013) 2e-10 Click
251045631..1046593 PHAGE_Xantho_Xp15: possible phage minor tail protein; EcE22_4869; phage(gi66392066) 4e-06 Click
261046654..1047205 conserved hypothetical protein; EcE22_4870 0.0 Click
271047271..1047411 conserved hypothetical protein; EcE22_4871 0.0 Click
281047577..1050786 PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; EcE22_4872; phage(gi169257221) 2e-117 Click
291051111..1051809 PHAGE_Entero_cdtI: putative minor tail protein; EcE22_4873; phage(gi148609397) 3e-125 Click
301051922..1052557 PHAGE_Entero_cdtI: putative tail protein; EcE22_4874; phage(gi148609398) 4e-126 Click
311052554..1053102 PHAGE_Entero_cdtI: putative tail component; EcE22_4875; phage(gi148609399) 1e-91 Click
321053163..1056576 PHAGE_Entero_cdtI: putative tail tip assembly protein; EcE22_4876; phage(gi148609400) 0.0 Click
331056646..1057245 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; EcE22_4877; phage(gi148609401) 7e-112 Click
34complement(1057246..1057419) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EcE22_4878; phage(gi157166059) 2e-29 Click
351058345..1058623 PHAGE_Entero_cdtI: putative tail fiber protein; EcE22_4880; phage(gi148609402) 4e-48 Click
361058625..1058894 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; EcE22_4881; phage(gi209447199) 8e-46 Click
371059104..1059694 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; EcE22_4882; phage(gi209427795) 7e-25 Click
381059745..1062117 PHAGE_Staphy_Twort: ORF044; EcE22_4883; phage(gi66391298) 3e-11 Click

Region 5, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11280616..1280637 attL    CCCTTACACGGGCTTATTTTTT 0.0 Click
2complement(1282353..1284077) PHAGE_Haemop_HP2: orf35; EcE22_1420; phage(gi17981851) 4e-125 Click
3complement(1284085..1284627) PHAGE_Haemop_HP2: orf34; EcE22_1421; phage(gi17981850) 4e-28 Click
4complement(1284599..1285333) PHAGE_Haemop_HP2: orf33; EcE22_1422; phage(gi17981849) 8e-16 Click
5complement(1285323..1285910) PHAGE_Entero_HK630: tail fiber assembly protein; EcE22_1423; phage(gi428782810) 3e-63 Click
6complement(1285910..1287874) PHAGE_Haemop_HP2: tail fibers; EcE22_1424; phage(gi17981847) 2e-71 Click
7complement(1287886..1288479) PHAGE_Haemop_HP2: orf30; EcE22_1425; phage(gi17981846) 2e-43 Click
8complement(1288472..1289656) PHAGE_Haemop_HP2: orf29; EcE22_1426; phage(gi17981845) 1e-105 Click
9complement(1289649..1289984) PHAGE_Haemop_HP2: orf28; EcE22_1427; phage(gi17981844) 6e-30 Click
10complement(1292097..1292234) PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_37; EcE22_1430; phage(gi148727165) 4e-10 Click
11complement(1292285..1292554) PHAGE_Haemop_HP2: orf26; EcE22_1431; phage(gi17981842) 2e-10 Click
12complement(1292551..1292688) hypothetical protein; EcE22_1432 0.0 Click
13complement(1292657..1293040) PHAGE_Erwini_phiEa104: hypothetical protein; EcE22_1433; phage(gi327198401) 2e-09 Click
14complement(1293040..1293378) PHAGE_Pseudo_PaP2: hypothetical protein PaP2_gp17; EcE22_1434; phage(gi48697087) 2e-21 Click
15complement(1293365..1293676) PHAGE_Burkho_KS9: holin gp22; EcE22_1435; phage(gi255033753) 2e-15 Click
16complement(1293681..1294136) PHAGE_Aeromo_phiO18P: putative tail tube protein; EcE22_1436; phage(gi148727159) 7e-40 Click
17complement(1294140..1295282) PHAGE_Haemop_HP2: tail sheath; EcE22_1437; phage(gi17981837) 2e-97 Click
18complement(1295285..1295980) PHAGE_Haemop_HP2: orf22; EcE22_1438; phage(gi17981836) 9e-12 Click
19complement(1295977..1296453) PHAGE_Haemop_HP2: orf21; EcE22_1439; phage(gi17981835) 1e-11 Click
20complement(1296450..1296923) PHAGE_Aeromo_phiO18P: putative head completion protein; EcE22_1440; phage(gi148727155) 7e-23 Click
21complement(1297026..1297727) PHAGE_Haemop_HP2: packaging protein; EcE22_1441; phage(gi17981833) 7e-44 Click
22complement(1297730..1298752) PHAGE_Aeromo_phiO18P: putative major capsid protein; EcE22_1442; phage(gi148727153) 6e-83 Click
23complement(1298781..1299842) PHAGE_Haemop_HP2: scaffold; EcE22_1443; phage(gi17981831) 8e-30 Click
241300019..1301830 PHAGE_Haemop_HP2: terminase; EcE22_1444; phage(gi17981830) 6e-164 Click
251301827..1302888 PHAGE_Haemop_HP2: orf15; EcE22_1445; phage(gi17981829) 5e-92 Click
261302936..1303211 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_19; EcE22_1446; phage(gi148727148) 6e-15 Click
27complement(1303474..1306266) hypothetical protein; EcE22_1447 0.0 Click
28complement(1306631..1309243) PHAGE_Salmon_RE_2010: replication protein; EcE22_1448; phage(gi418489692) 6e-133 Click
29complement(1309240..1310130) PHAGE_Erwini_phiEaH2: DNA adenine methylase; EcE22_1449; phage(gi431810598) 2e-59 Click
30complement(1310201..1310590) hypothetical protein; EcE22_1450 0.0 Click
31complement(1310606..1310899) hypothetical phage-related protein; EcE22_1451 0.0 Click
321310966..1311445 hypothetical protein; EcE22_1452 0.0 Click
33complement(1311450..1311584) hypothetical protein; EcE22_1453 0.0 Click
341312664..1313677 PHAGE_Salmon_RE_2010: integrase; EcE22_1454; phage(gi418489683) 5e-61 Click
351313767..1313788 attR    CCCTTACACGGGCTTATTTTTT 0.0 Click

Region 6, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11887336..1887348 attL    AAAGAACGCGAGC 0.0 Click
2complement(1896812..1897117) PHAGE_Entero_HK629: tail fiber assembly protein; EcE22_5533; phage(gi428782036) 1e-14 Click
3complement(1898515..1898667) hypothetical protein; EcE22_5534 0.0 Click
41898942..1899532 PHAGE_Entero_P1: Cin; EcE22_5535; phage(gi46401653) 2e-24 Click
5complement(1899630..1900205) PHAGE_Entero_HK629: tail fiber assembly protein; EcE22_5536; phage(gi428782036) 3e-106 Click
6complement(1900205..1901755) PHAGE_Entero_HK629: tail fiber; EcE22_5537; phage(gi428782035) 2e-87 Click
7complement(1901716..1901850) hypothetical protein; EcE22_5538 0.0 Click
81901886..1902623 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; EcE22_5539; phage(gi169257204) 1e-12 Click
91903011..1903184 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EcE22_5540; phage(gi157166059) 2e-29 Click
10complement(1903185..1903784) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; EcE22_5541; phage(gi148609401) 2e-111 Click
11complement(1903851..1907249) PHAGE_Entero_HK629: tail fiber; EcE22_5542; phage(gi428782032) 0.0 Click
12complement(1908604..1909302) PHAGE_Entero_HK629: minor tail protein; EcE22_5546; phage(gi428782029) 2e-135 Click
13complement(1909302..1909631) PHAGE_Entero_HK629: minor tail protein; EcE22_5547; phage(gi428782028) 3e-60 Click
14complement(1912102..1912536) PHAGE_Entero_HK629: tail assembly protein; EcE22_5550; phage(gi428782026) 2e-81 Click
15complement(1912518..1912940) PHAGE_Entero_HK629: minor tail protein; EcE22_5551; phage(gi428782025) 5e-76 Click
16complement(1912956..1913696) PHAGE_Entero_HK629: major tail protein; EcE22_5552; phage(gi428782024) 8e-139 Click
17complement(1913704..1914099) PHAGE_Entero_HK629: minor tail protein; EcE22_5553; phage(gi428782023) 2e-72 Click
18complement(1914096..1914674) PHAGE_Entero_HK629: minor tail protein; EcE22_5554; phage(gi428782022) 1e-101 Click
19complement(1914686..1915039) PHAGE_Entero_HK629: head-tail connector Fii; EcE22_5555; phage(gi428782021) 4e-64 Click
20complement(1915051..1915449) PHAGE_Entero_HK629: DNA packaging protein Fi; EcE22_5556; phage(gi428782020) 1e-67 Click
21complement(1915491..1916516) PHAGE_Entero_HK629: major head subunit; EcE22_5557; phage(gi428782019) 0.0 Click
22complement(1916572..1916904) PHAGE_Entero_HK629: head decoration protein; EcE22_5558; phage(gi428782018) 1e-58 Click
23complement(1916914..1918233) PHAGE_Entero_HK629: head maturation protease; EcE22_5559; phage(gi428782016) 0.0 Click
24complement(1918214..1919815) PHAGE_Entero_HK629: portal protein; EcE22_5560; phage(gi428782015) 0.0 Click
25complement(1919812..1920018) PHAGE_Entero_HK629: head-tail connector; EcE22_5561; phage(gi428782014) 4e-32 Click
26complement(1920015..1921940) PHAGE_Entero_HK629: terminase large subunit A; EcE22_5562; phage(gi428782013) 0.0 Click
27complement(1921915..1922460) PHAGE_Entero_HK629: terminase small subunit nu1; EcE22_5563; phage(gi428782012) 4e-98 Click
281922849..1923043 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EcE22_5564; phage(gi209427772) 8e-20 Click
29complement(1923208..1923414) PHAGE_Entero_HK629: hypothetical protein; EcE22_5565; phage(gi428782080) 1e-32 Click
301923700..1924110 PHAGE_Entero_HK629: putative envelope protein; EcE22_5566; phage(gi428782079) 2e-74 Click
311924401..1924694 PHAGE_Escher_TL_2011c: Bor protein precursor; EcE22_5567; phage(gi418487071) 2e-49 Click
32complement(1924726..1925187) PHAGE_Entero_HK629: cell lysis protein Rz; EcE22_5568; phage(gi428782076) 6e-80 Click
33complement(1925184..1925681) PHAGE_Entero_cdtI: lysin; EcE22_5569; phage(gi148609440) 3e-92 Click
34complement(1925681..1925896) PHAGE_Stx2_c_II: holin; EcE22_5570; phage(gi302393164) 3e-28 Click
351934447..1934459 attR    AAAGAACGCGAGC 0.0 Click

Region 7, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2952851..2953405) PHAGE_Entero_2: DNA-invertase; EcE22_1238; phage(gi169936026) 3e-88 Click
22953435..2953983 PHAGE_Entero_HK106: side tail fiber protein; EcE22_1239; phage(gi428783303) 3e-45 Click
32953983..2954585 PHAGE_Entero_HK106: tail fiber assembly protein; EcE22_1241; phage(gi428783304) 9e-99 Click
4complement(2954557..2954997) PHAGE_Entero_mEp213: tail fiber assembly protein; EcE22_1240; phage(gi428782612) 1e-22 Click
5complement(2955000..2955641) PHAGE_Salmon_ST64B: tail protein; EcE22_1242; phage(gi23505468) 2e-21 Click
6complement(2955645..2956229) PHAGE_Salmon_ST64B: putative tail protein; EcE22_1243; phage(gi23505467) 4e-62 Click
7complement(2956220..2957278) PHAGE_Salmon_ST64B: putative head assembly protein; EcE22_1244; phage(gi23505465) 2e-53 Click
8complement(2957265..2957690) PHAGE_Salmon_ST64B: putative tail protein; EcE22_1245; phage(gi23505464) 2e-40 Click
9complement(2957690..2958238) PHAGE_Salmon_ST64B: putative base plate assembly protein; EcE22_1246; phage(gi23505463) 1e-58 Click
10complement(2958238..2959317) PHAGE_Salmon_ST64B: Tail protein; EcE22_1247; phage(gi23505462) 2e-135 Click
11complement(2959314..2960642) PHAGE_Salmon_ST64B: tail/DNA circulation protein; EcE22_1248; phage(gi23505461) 6e-97 Click
12complement(2960703..2962538) PHAGE_Salmon_ST64B: tail protein; EcE22_1249; phage(gi23505460) 1e-30 Click
13complement(2962680..2962949) PHAGE_Salmon_ST64B: hypothetical protein sb15; EcE22_1250; phage(gi23505501) 3e-14 Click
14complement(2962949..2963305) PHAGE_Salmon_ST64B: Tail tube protein; EcE22_1251; phage(gi23505459) 3e-52 Click
15complement(2963305..2964801) PHAGE_Salmon_ST64B: Tail Sheath protein; EcE22_1252; phage(gi23505458) 0.0 Click
16complement(2964785..2964898) PHAGE_Salmon_ST64B: hypothetical protein sb12; EcE22_1253; phage(gi23505457) 1e-10 Click
17complement(2964964..2965524) PHAGE_Salmon_ST64B: hypothetical protein sb11; EcE22_1254; phage(gi23505456) 7e-76 Click
18complement(2965521..2966027) PHAGE_Salmon_ST64B: hypothetical protein sb10; EcE22_1255; phage(gi23505455) 1e-72 Click
19complement(2966002..2966412) PHAGE_Salmon_ST64B: hypothetical protein sb9; EcE22_1256; phage(gi23505454) 5e-41 Click
20complement(2966409..2966732) PHAGE_Salmon_ST64B: hypothetical protein sb8; EcE22_1257; phage(gi23505453) 2e-49 Click
21complement(2966735..2966935) PHAGE_Salmon_ST64B: hypothetical protein sb7; EcE22_1258; phage(gi23505452) 2e-24 Click
22complement(2966985..2968190) PHAGE_Salmon_ST64B: Major capsid protein precursor; EcE22_1259; phage(gi23505451) 0.0 Click
23complement(2968205..2968855) PHAGE_Salmon_ST64B: Pro-head protease; EcE22_1260; phage(gi23505450) 5e-119 Click
24complement(2968833..2970074) PHAGE_Salmon_ST64B: Portal Protein; EcE22_1261; phage(gi23505449) 0.0 Click
25complement(2970074..2970256) PHAGE_Salmon_ST64B: putative integral membrane protein; EcE22_1262; phage(gi23505448) 2e-28 Click
26complement(2970268..2972001) PHAGE_Salmon_ST64B: Terminase large subunit; EcE22_1263; phage(gi23505447) 0.0 Click
27complement(2971998..2972492) PHAGE_Salmon_ST64B: terminase small subunit; EcE22_1264; phage(gi23505446) 4e-84 Click
28complement(2972618..2972968) PHAGE_Salmon_ST64B: hypothetical protein sb56; EcE22_1265; phage(gi23505500) 2e-63 Click
292973287..2973505 hypothetical protein; EcE22_1266 0.0 Click
30complement(2973939..2974331) PHAGE_Entero_SfV: putative Rz lytic protein; EcE22_1267; phage(gi19549038) 1e-54 Click
31complement(2974315..2974791) PHAGE_Entero_SfV: lysin; EcE22_1268; phage(gi19549037) 3e-86 Click
32complement(2974795..2975130) PHAGE_Salmon_ST64B: lysis protein (holin); EcE22_1269; phage(gi23505495) 6e-23 Click
33complement(2975207..2975581) PHAGE_Entero_mEp460: DNA methylase; EcE22_1270; phage(gi428782369) 3e-59 Click

Region 8, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13435998..3436012 attL    AAATTTGTTGCTGTT 0.0 Click
23436543..3437736 PHAGE_Entero_mEp237: integrase; EcE22_2574; phage(gi435439292) 0.0 Click
3complement(3437972..3438106) PHAGE_Entero_mEp237: hypothetical protein; EcE22_2575; phage(gi435439294) 9e-19 Click
4complement(3438253..3439368) PHAGE_Entero_mEp237: recombinase RecT; EcE22_2576; phage(gi435439295) 0.0 Click
5complement(3439377..3442766) PHAGE_Entero_mEp237: exonuclease; EcE22_2577; phage(gi435439296) 0.0 Click
6complement(3442906..3443067) PHAGE_Entero_mEp237: hypothetical protein; EcE22_2578; phage(gi435439297) 1e-26 Click
7complement(3443079..3443387) PHAGE_Entero_mEp237: Kil protein; EcE22_2579; phage(gi435439298) 2e-35 Click
83443670..3443876 PHAGE_Entero_HK225: hypothetical protein; EcE22_2580; phage(gi428782417) 2e-18 Click
9complement(3443907..3444068) hypothetical protein; EcE22_2581 0.0 Click
103444070..3444204 hypothetical protein; EcE22_2582 0.0 Click
11complement(3445146..3445280) PHAGE_Entero_mEp237: prophage repressor; EcE22_2583; phage(gi435439304) 4e-13 Click
123445720..3445878 PHAGE_Entero_mEp237: prophage anti-repressor; EcE22_2584; phage(gi435439305) 4e-11 Click
133445881..3446420 PHAGE_Entero_mEp237: CII protein; EcE22_2585; phage(gi435439306) 4e-97 Click
143446505..3447413 PHAGE_Entero_mEp237: DNA replication protein O; EcE22_2586; phage(gi435439307) 9e-178 Click
153447410..3448099 PHAGE_Entero_mEp237: DNA replication protein P; EcE22_2587; phage(gi435439308) 1e-132 Click
163448101..3448301 PHAGE_Entero_mEp237: Ren protein; EcE22_2588; phage(gi435439309) 6e-09 Click
17complement(3448743..3448856) hypothetical protein; EcE22_2589 0.0 Click
183449063..3449308 PHAGE_Entero_mEp237: hypothetical protein; EcE22_2590; phage(gi435439313) 2e-40 Click
193449558..3449674 PHAGE_Entero_mEp237: hypothetical protein; EcE22_2591; phage(gi435439314) 7e-16 Click
203449709..3450308 PHAGE_Entero_mEp237: hypothetical protein; EcE22_2592; phage(gi435439315) 5e-106 Click
213450371..3450514 PHAGE_Entero_mEp237: hypothetical protein; EcE22_2593; phage(gi435439316) 3e-12 Click
223450511..3450798 PHAGE_Entero_HK225: hypothetical protein; EcE22_2594; phage(gi428782439) 3e-48 Click
233450795..3451151 PHAGE_Entero_HK225: endodeoxyribonuclease; EcE22_2595; phage(gi428782440) 7e-63 Click
243451148..3451285 PHAGE_Entero_mEp237: hypothetical protein; EcE22_2596; phage(gi435439319) 2e-07 Click
253451285..3452094 PHAGE_Entero_mEp237: late gene regulator Q; EcE22_2597; phage(gi435439320) 3e-53 Click
263452505..3452579 tRNA 0.0 Click
273453008..3453763 conserved hypothetical protein; EcE22_2599 0.0 Click
283453763..3454167 conserved hypothetical protein; EcE22_2600 0.0 Click
293454377..3455429 PHAGE_Entero_cdtI: putative DNA methylase; EcE22_2601; phage(gi148609438) 2e-174 Click
303455498..3455800 PHAGE_Entero_N15: gp53; EcE22_2602; phage(gi9630496) 6e-35 Click
313455800..3456333 PHAGE_Entero_mEp237: lysin; EcE22_2603; phage(gi435439323) 2e-89 Click
323456315..3456794 PHAGE_Entero_HK630: cell lysis protein Rz; EcE22_2604; phage(gi428782852) 7e-44 Click
333457091..3457231 hypothetical protein; EcE22_2605 0.0 Click
343457296..3457949 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; EcE22_2606; phage(gi148912828) 2e-08 Click
353458189..3458758 conserved hypothetical protein; EcE22_2607 0.0 Click
363458910..3460823 PHAGE_Vibrio_VHML: ORF22; EcE22_2608; phage(gi27311189) 3e-60 Click
373461155..3462732 PHAGE_Provid_Redjac: phage portal protein; EcE22_2609; phage(gi410490794) 2e-66 Click
383462729..3463595 PHAGE_Entero_Enc34: prohead protease; EcE22_2610; phage(gi422936746) 7e-49 Click
393463597..3464187 PHAGE_Pseudo_Lu11: hypothetical protein; EcE22_2611; phage(gi388684814) 2e-11 Click
403464689..3465738 PHAGE_Burkho_BcepNazgul: capsid protein E; EcE22_2613; phage(gi34610166) 4e-44 Click
413465740..3466120 hypothetical protein; EcE22_2614 0.0 Click
423466125..3466484 conserved hypothetical protein; EcE22_2615 0.0 Click
433466481..3467026 conserved hypothetical protein; EcE22_2616 0.0 Click
443467087..3467227 conserved domain protein; EcE22_2617 0.0 Click
453467224..3468726 PHAGE_Entero_SfV: tail sheath protein; EcE22_2618; phage(gi19549001) 9e-105 Click
463468730..3469101 PHAGE_Salmon_ST64B: Tail tube protein; EcE22_2619; phage(gi23505459) 6e-07 Click
473469103..3469381 conserved hypothetical protein; EcE22_2620 0.0 Click
483469396..3469530 hypothetical protein; EcE22_2621 0.0 Click
493469523..3471451 PHAGE_Entero_K1F: internal virion protein; EcE22_2622; phage(gi77118204) 4e-19 Click
503471795..3473198 PHAGE_Entero_SfV: tail/DNA circulation protein; EcE22_2623; phage(gi19549005) 2e-29 Click
513473195..3474280 PHAGE_Salmon_ST64B: Tail protein; EcE22_2624; phage(gi23505462) 4e-42 Click
523474319..3474861 PHAGE_Salmon_ST64B: putative base plate assembly protein; EcE22_2625; phage(gi23505463) 6e-16 Click
533474858..3475295 PHAGE_Entero_SfV: tail protein; EcE22_2626; phage(gi19549008) 5e-11 Click
543475297..3476439 PHAGE_Entero_SfV: tail protein; EcE22_2627; phage(gi19549009) 4e-31 Click
553476436..3477029 PHAGE_Entero_SfV: tail protein; EcE22_2628; phage(gi19548988) 1e-27 Click
563477081..3477872 PHAGE_Entero_HK97: tail fiber; EcE22_2629; phage(gi9634179) 1e-47 Click
573477872..3478474 PHAGE_Entero_HK106: tail fiber assembly protein; EcE22_2631; phage(gi428783304) 1e-98 Click
58complement(3478446..3478889) PHAGE_Entero_mEp213: tail fiber assembly protein; EcE22_2630; phage(gi428782612) 6e-28 Click
593479083..3479256 hypothetical protein; EcE22_2632 0.0 Click
603479316..3479864 PHAGE_Entero_mEp237: DNA invertase; EcE22_2633; phage(gi435439291) 2e-100 Click
61complement(3479983..3480279) protein YciI; EcE22_2634 0.0 Click
623480488..3481222 PHAGE_Parame_NY2A: hypothetical protein NY2A_B322R; EcE22_2635; phage(gi157952626) 2e-12 Click
63complement(3481262..3481660) acyl-CoA thioesterase YciA; EcE22_2636 0.0 Click
64complement(3481765..3482304) intracellular septation protein A; EcE22_2637 0.0 Click
653482846..3482860 attR    AAATTTGTTGCTGTT 0.0 Click
663483434..3484072 outer membrane protein W; EcE22_2639 0.0 Click
67complement(3484118..3485248) PHAGE_Entero_mEp235: integrase; EcE22_2640; phage(gi428781836) 7e-56 Click

Region 9, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3905102..3906148) PHAGE_Erwini_ENT90: phage portal protein; EcE22_2272; phage(gi431810941) 7e-92 Click
2complement(3906148..3907899) PHAGE_Yersin_413C: gpP; EcE22_2273; phage(gi30065706) 3e-132 Click
33908054..3908890 PHAGE_Salmon_RE_2010: capsid scaffolding protein; EcE22_2274; phage(gi418489698) 2e-45 Click
43908914..3909966 PHAGE_Yersin_413C: gpN; EcE22_2275; phage(gi30065708) 5e-73 Click
53910012..3910812 PHAGE_Ralsto_phiRSA1: terminase; EcE22_2276; phage(gi145708083) 1e-35 Click
63910914..3911408 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); EcE22_2277; phage(gi134288689) 3e-26 Click
73911408..3911608 PHAGE_Yersin_413C: gpX; EcE22_2278; phage(gi30065711) 9e-11 Click
83911611..3911934 PHAGE_Aeromo_phiO18P: putative holin; EcE22_2279; phage(gi148727161) 1e-09 Click
93911931..3912323 PHAGE_Entero_phiP27: putative endolysin; EcE22_2280; phage(gi18249894) 2e-53 Click
103912320..3912727 conserved hypothetical protein; EcE22_2281 0.0 Click
113912865..3913332 PHAGE_Yersin_413C: gpR; EcE22_2282; phage(gi30065716) 8e-19 Click
123913316..3913960 PHAGE_Pseudo_phiCTX: predicted tail completion; EcE22_2283; phage(gi17313233) 6e-20 Click
133913957..3914538 PHAGE_Yersin_413C: gpV; EcE22_2284; phage(gi30065718) 3e-42 Click
143914535..3914885 PHAGE_Yersin_413C: gpW; EcE22_2285; phage(gi30065719) 1e-21 Click
153914889..3915785 PHAGE_Yersin_413C: gpJ; EcE22_2286; phage(gi30065720) 1e-85 Click
163915778..3916386 PHAGE_Salmon_RE_2010: tail protein I; EcE22_2287; phage(gi418489712) 2e-63 Click
173916383..3918023 PHAGE_Yersin_413C: gpH; EcE22_2288; phage(gi30065722) 3e-65 Click
183918020..3918625 PHAGE_Entero_HK106: tail fiber assembly protein; EcE22_2290; phage(gi428783304) 1e-100 Click
19complement(3918597..3919016) PHAGE_Entero_mEp213: tail fiber assembly protein; EcE22_2289; phage(gi428782612) 4e-24 Click
203918995..3919126 hypothetical protein; EcE22_2291 0.0 Click
213919449..3920048 PHAGE_Entero_2: DNA-invertase; EcE22_2292; phage(gi169936026) 3e-80 Click
22complement(3920075..3920563) PROPHAGE_Salmon_Ty2: putative phage tail protein; EcE22_2293; phage(gi29143763) 4e-39 Click
23complement(3920576..3923383) PHAGE_Yersin_413C: gpT; EcE22_2294; phage(gi30065729) 2e-105 Click
24complement(3923370..3923498) PHAGE_Yersin_413C: gpE+E'; EcE22_2295; phage(gi30065728) 5e-06 Click
25complement(3923534..3923899) PROPHAGE_Salmon_Ty2: putative phage tail protein; EcE22_2296; phage(gi29143760) 2e-06 Click
26complement(3923954..3924466) PROPHAGE_Salmon_Ty2: major tail tube protein; EcE22_2297; phage(gi29143759) 5e-35 Click
27complement(3924466..3925650) PHAGE_Erwini_ENT90: tail sheath protein; EcE22_2298; phage(gi431810939) 4e-101 Click
283925630..3925761 hypothetical protein; EcE22_2299 0.0 Click
293925808..3926905 PHAGE_Yersin_413C: gpD; EcE22_2300; phage(gi30065731) 2e-94 Click
30complement(3927122..3927946) conserved hypothetical protein; EcE22_2301 0.0 Click
313928123..3928383 PHAGE_Yersin_413C: Ogr; EcE22_2302; phage(gi30065732) 1e-07 Click
323928574..3928714 PHAGE_Escher_P13374: prophage host toxic membrane protein; EcE22_2303; phage(gi410491667) 1e-15 Click
33complement(3929015..3929314) PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; EcE22_2304; phage(gi9630187) 4e-15 Click

Region 10, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14052113..4052125 attL    TGGATGAAAGTTT 0.0 Click
24059082..4059588 PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; EcE22_5347; phage(gi17546156) 2e-20 Click
3complement(4060900..4061409) PHAGE_Entero_N15: gp1; EcE22_0268; phage(gi9630465) 4e-19 Click
4complement(4061531..4061656) conserved hypothetical protein; EcE22_0269 0.0 Click
54061864..4061989 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EcE22_0270; phage(gi209427772) 4e-08 Click
6complement(4062122..4062262) conserved hypothetical protein; EcE22_0271 0.0 Click
7complement(4062349..4062471) hypothetical protein; EcE22_0272 0.0 Click
8complement(4062613..4063080) PHAGE_Stx2_c_I: endopeptidase; EcE22_0273; phage(gi20065955) 2e-70 Click
9complement(4063082..4063219) putative bacteriophage protein; EcE22_0274 0.0 Click
10complement(4063379..4063912) PHAGE_Entero_4795: putative R protein; EcE22_0275; phage(gi157166033) 7e-100 Click
11complement(4064488..4064943) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; EcE22_0277; phage(gi116221997) 1e-59 Click
12complement(4064948..4065154) PHAGE_Stx2_c_1717: holin protein S-like protein; EcE22_0278; phage(gi209447171) 1e-32 Click
13complement(4065447..4067297) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EcE22_0279; phage(gi209427766) 0.0 Click
14complement(4067773..4067851) tRNA 0.0 Click
15complement(4067863..4067941) tRNA 0.0 Click
16complement(4067948..4068019) tRNA 0.0 Click
174068146..4069090 hypothetical protein; EcE22_0283 0.0 Click
18complement(4069227..4070042) PHAGE_Salmon_1: bacteriophage antitermination protein Q; EcE22_0284; phage(gi169257178) 2e-131 Click
19complement(4070042..4070899) PHAGE_Salmon_1: hypothetical protein STM0902.Fels1; EcE22_0285; phage(gi169257177) 1e-135 Click
20complement(4070899..4071867) PHAGE_Salmon_1: putative bacteriophage DNA primase; EcE22_0286; phage(gi169257176) 1e-178 Click
21complement(4071869..4073527) PHAGE_Salmon_1: putative helicase; EcE22_0287; phage(gi169257175) 0.0 Click
22complement(4073639..4074007) PHAGE_Salmon_1: hypothetical protein STM0899.Fels1; EcE22_0288; phage(gi169257174) 9e-59 Click
23complement(4074553..4074672) hypothetical protein; EcE22_0289 0.0 Click
24complement(4074877..4075218) hypothetical protein; EcE22_0290 0.0 Click
254075343..4075474 putative transcriptional regulator DicA; EcE22_0291 0.0 Click
264075887..4076030 PHAGE_Entero_phiP27: hypothetical protein P27p10; EcE22_0292; phage(gi18249874) 6e-07 Click
274076220..4076411 hypothetical protein; EcE22_0293 0.0 Click
284076596..4076955 PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; EcE22_0294; phage(gi169257166) 2e-30 Click
294076955..4077170 PHAGE_Entero_phiP27: hypothetical protein P27p07; EcE22_0295; phage(gi18249871) 3e-08 Click
304077357..4077749 PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; EcE22_0296; phage(gi169257164) 9e-40 Click
314077995..4078822 PHAGE_Entero_phiP27: putative serine protease; EcE22_0297; phage(gi18249869) 2e-154 Click
324078851..4079234 PHAGE_Entero_phiP27: hypothetical protein P27p04; EcE22_0298; phage(gi18249868) 2e-64 Click
334079266..4079382 PHAGE_Entero_phiP27: hypothetical protein P27p03; EcE22_0299; phage(gi18249867) 4e-13 Click
344079401..4079413 attR    TGGATGAAAGTTT 0.0 Click
354079540..4079680 PHAGE_Entero_2008: putative excisionase; EcE22_0300; phage(gi209427728) 8e-23 Click
364079714..4081000 PHAGE_Entero_2008: putative integrase; EcE22_0301; phage(gi209427727) 0.0 Click
374080966..4081781 protein of unknown function; EcE22_0302 0.0 Click
384081834..4082229 putative inner membrane protein; EcE22_0303 0.0 Click
394082270..4083013 PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; EcE22_0304; phage(gi333798309) 1e-24 Click

Region 11, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14207631..4207642 attL    TGCTCCGGGCTA 0.0 Click
2complement(4207761..4208831) PHAGE_Entero_lambda: integration protein; EcE22_2680; phage(gi9626273) 0.0 Click
34209536..4209658 conserved hypothetical protein; EcE22_2681 0.0 Click
44209930..4210079 conserved hypothetical protein; EcE22_2682 0.0 Click
5complement(4213085..4213228) PHAGE_Entero_lambda: host-killing protein; EcE22_2688; phage(gi9626283) 4e-20 Click
6complement(4213434..4213802) PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; EcE22_2689; phage(gi9626285) 6e-68 Click
7complement(4213991..4214860) hypothetical protein; EcE22_2690 0.0 Click
8complement(4214869..4215192) PHAGE_Entero_lambda: early gene regulator; EcE22_2691; phage(gi9626289) 2e-52 Click
9complement(4215365..4215490) hypothetical protein; EcE22_2692 0.0 Click
104216729..4216896 PHAGE_Entero_HK633: prophage antirepressor; EcE22_2693; phage(gi428782568) 1e-25 Click
114217172..4217309 PHAGE_Entero_lambda: cII protein; EcE22_2694; phage(gi9626294) 3e-18 Click
124217342..4218241 PHAGE_Entero_lambda: DNA replication protein; EcE22_2695; phage(gi9626295) 8e-174 Click
134218238..4218939 PHAGE_Entero_lambda: DNA replication protein; EcE22_2696; phage(gi9626296) 2e-129 Click
144218936..4219226 PHAGE_Entero_lambda: ren exclusion protein; EcE22_2697; phage(gi9626297) 2e-49 Click
154219300..4219740 PHAGE_Entero_lambda: NinB; EcE22_2698; phage(gi9626298) 4e-81 Click
164219737..4220264 PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); EcE22_2699; phage(gi428782650) 1e-100 Click
174220600..4221214 PHAGE_Entero_lambda: NinG protein; EcE22_2700; phage(gi9626303) 2e-119 Click
184221211..4221876 PHAGE_Stx2_c_1717: NinI protein; EcE22_2701; phage(gi209447164) 2e-126 Click
19complement(4222088..4223047) putative outer membrane protein; EcE22_2702 0.0 Click
204223522..4224211 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; EcE22_2703; phage(gi169257244) 3e-81 Click
214224423..4225139 conserved hypothetical protein; EcE22_2704 0.0 Click
224225225..4225383 PHAGE_Entero_P1: TciB; EcE22_2705; phage(gi46401695) 3e-06 Click
234225682..4227532 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EcE22_2706; phage(gi209427766) 0.0 Click
24complement(4227811..4227972) conserved hypothetical protein; EcE22_2707 0.0 Click
254227980..4228186 PHAGE_Stx2_c_1717: holin protein S-like protein; EcE22_2708; phage(gi209447171) 3e-33 Click
264228186..4228683 PHAGE_Stx2_c_1717: phage-related lysozyme; EcE22_2709; phage(gi209447172) 6e-94 Click
274228680..4229117 PHAGE_Stx2_c_1717: putative Rz lysis protein; EcE22_2710; phage(gi209447173) 3e-75 Click
284230413..4230538 conserved hypothetical protein; EcE22_2713 0.0 Click
294230660..4231169 PHAGE_Entero_N15: gp1; EcE22_2714; phage(gi9630465) 4e-19 Click
304231141..4233069 PHAGE_Entero_lambda: DNA packaging protein; EcE22_2715; phage(gi9626245) 0.0 Click
314233053..4233259 PHAGE_Entero_mEp237: head-tail connector; EcE22_2716; phage(gi435439268) 1e-13 Click
324236377..4236724 PHAGE_Entero_lambda: head-DNA stabilization protein; EcE22_2720; phage(gi9626250) 1e-24 Click
334236782..4237810 PHAGE_Entero_lambda: capsid component; EcE22_2721; phage(gi9626251) 2e-116 Click
344237862..4238245 PHAGE_Entero_HK225: head assembly protein Fi; EcE22_2722; phage(gi428782384) 4e-05 Click
354238238..4238591 PHAGE_Entero_lambda: head-tail joining protein; EcE22_2723; phage(gi9626253) 5e-43 Click
364238606..4239139 PHAGE_Entero_lambda: tail component; EcE22_2724; phage(gi9626254) 5e-65 Click
374239136..4239531 PHAGE_Entero_lambda: tail component; EcE22_2725; phage(gi9626255) 3e-59 Click
384241500..4241913 DNA polymerase III, psi subunit; EcE22_0458 0.0 Click
394241882..4242328 ribosomal-protein-alanine acetyltransferase; EcE22_0459 0.0 Click
404242343..4243020 PHAGE_Strept_VWB: hypothetical protein VWBp55; EcE22_0460; phage(gi41057269) 9e-06 Click
414250684..4250695 attR    TGCTCCGGGCTA 0.0 Click

Region 12, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4817793..4819184) PHAGE_Stx2_c_1717: transposase; EcE22_0542; phage(gi209447153) 0.0 Click
2complement(4819669..4820301) hypothetical protein; EcE22_0543 0.0 Click
3complement(4820416..4820814) PHAGE_Burkho_BcepMu: gp01; EcE22_0544; phage(gi48696911) 2e-32 Click
4complement(4820786..4821235) PHAGE_Burkho_BcepMu: gp02; EcE22_0545; phage(gi48696912) 8e-26 Click
5complement(4821228..4821443) conserved hypothetical protein; EcE22_0546 0.0 Click
6complement(4821433..4821663) conserved hypothetical protein; EcE22_0547 0.0 Click
7complement(4821660..4822343) PHAGE_Pseudo_JBD24: hypothetical protein; EcE22_0548; phage(gi448245062) 5e-28 Click
8complement(4822340..4822555) conserved hypothetical protein; EcE22_0549 0.0 Click
9complement(4822570..4822866) conserved hypothetical protein; EcE22_0550 0.0 Click
10complement(4822876..4823148) conserved hypothetical protein; EcE22_0551 0.0 Click
11complement(4823145..4823270) conserved hypothetical protein; EcE22_0552 0.0 Click
124823286..4823426 hypothetical protein; EcE22_0553 0.0 Click
13complement(4823437..4823967) PHAGE_Pseudo_MP42: host nuclease inhibitor protein; EcE22_0554; phage(gi399528592) 4e-61 Click
14complement(4823995..4824264) conserved hypothetical protein; EcE22_0555 0.0 Click
15complement(4824267..4825433) PHAGE_Burkho_BcepMu: gp08; EcE22_0556; phage(gi48696918) 2e-124 Click
16complement(4825444..4827213) PHAGE_Burkho_BcepMu: gp09; EcE22_0557; phage(gi48696919) 0.0 Click
17complement(4827217..4828128) PHAGE_Burkho_BcepMu: gp10; EcE22_0558; phage(gi48696920) 9e-40 Click
18complement(4828139..4828447) PHAGE_Burkho_BcepMu: gp12; EcE22_0559; phage(gi48696922) 4e-09 Click
19complement(4828500..4828688) PHAGE_Burkho_BcepMu: gp16; EcE22_0560; phage(gi48696926) 2e-08 Click
204828789..4829127 PHAGE_Burkho_BcepMu: gp17; EcE22_0561; phage(gi48696927) 9e-10 Click
21complement(4829243..4830007) PHAGE_Vibrio_VP882: DNA adenine methylase; EcE22_0562; phage(gi126010878) 1e-97 Click
224830202..4830582 conserved hypothetical protein; EcE22_0563 0.0 Click
23complement(4830832..4831047) hypothetical protein; EcE22_0564 0.0 Click
244831049..4831450 hypothetical protein; EcE22_0566 0.0 Click
25complement(4831426..4832169) hypothetical protein; EcE22_0565 0.0 Click
264832300..4832650 PHAGE_Burkho_BcepMu: gp21; EcE22_0567; phage(gi48696931) 1e-26 Click
274832653..4833378 PHAGE_Burkho_BcepMu: gp22; EcE22_0568; phage(gi48696932) 5e-61 Click
284833407..4834018 PHAGE_Burkho_BcepMu: gp23; EcE22_0569; phage(gi48696933) 5e-09 Click
294834015..4834341 PHAGE_Burkho_BcepMu: gp25; EcE22_0570; phage(gi48696935) 8e-22 Click
304834341..4834652 PHAGE_Burkho_BcepMu: gp26; EcE22_0571; phage(gi48696936) 8e-30 Click
314834655..4835197 PHAGE_Burkho_BcepMu: gp27; EcE22_0572; phage(gi48696937) 5e-48 Click
324835194..4836717 PHAGE_Burkho_BcepMu: gp28; EcE22_0573; phage(gi48696938) 0.0 Click
334836717..4838210 PHAGE_Burkho_BcepMu: gp29; EcE22_0574; phage(gi48696939) 3e-167 Click
344838191..4839012 PHAGE_Burkho_BcepMu: gp30; EcE22_0575; phage(gi48696940) 1e-98 Click
354839015..4839473 PHAGE_Burkho_BcepMu: gp31; EcE22_0576; phage(gi48696941) 9e-33 Click
364839688..4840803 PHAGE_Burkho_BcepMu: gp32; EcE22_0577; phage(gi48696942) 1e-99 Click
374840818..4841771 PHAGE_Burkho_BcepMu: gp34; EcE22_0578; phage(gi48696944) 8e-68 Click
384841781..4842119 PHAGE_Burkho_BcepMu: gp35; EcE22_0579; phage(gi48696945) 5e-22 Click
394842121..4842567 PHAGE_Burkho_BcepMu: gp36; EcE22_0580; phage(gi48696946) 3e-36 Click
404842567..4843031 PHAGE_Burkho_BcepMu: gp37; EcE22_0581; phage(gi48696947) 8e-42 Click
414843031..4843282 PHAGE_Burkho_BcepMu: gp38; EcE22_0582; phage(gi48696948) 1e-08 Click
424843272..4844699 PHAGE_Burkho_BcepMu: gp39; EcE22_0583; phage(gi48696949) 0.0 Click
434844699..4845220 PHAGE_Burkho_BcepMu: gp40; EcE22_0584; phage(gi48696950) 3e-68 Click
44complement(4845367..4845510) hypothetical protein; EcE22_0585 0.0 Click
454845602..4845937 PHAGE_Burkho_BcepMu: gp41; EcE22_0586; phage(gi48696951) 3e-05 Click
464846112..4848577 PHAGE_Burkho_BcepMu: gp44; EcE22_0587; phage(gi48696954) 0.0 Click
474848577..4849461 PHAGE_Burkho_BcepMu: gp45; EcE22_0588; phage(gi48696955) 2e-76 Click
484849461..4849673 PHAGE_Burkho_BcepMu: gp46; EcE22_0589; phage(gi48696956) 1e-19 Click
494849661..4850815 PHAGE_Burkho_BcepMu: gp47; EcE22_0590; phage(gi48696957) 3e-90 Click
504850812..4851339 PHAGE_Burkho_BcepMu: gp48; EcE22_0591; phage(gi48696958) 3e-31 Click
51complement(4851408..4851548) hypothetical protein; EcE22_0592 0.0 Click
524851734..4852837 PHAGE_Burkho_BcepMu: gp50; EcE22_0593; phage(gi48696960) 9e-111 Click
534852830..4853408 PHAGE_Burkho_BcepMu: gp51; EcE22_0594; phage(gi48696961) 2e-62 Click

Region 13, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14947494..4947506 attL    ATTGCCTGATGCG 0.0 Click
24951253..4951720 PHAGE_Xylell_Xfas53: inner membrane protein; EcE22_2523; phage(gi273810461) 5e-07 Click
3complement(4951797..4952915) PHAGE_Entero_HK106: integrase; EcE22_2524; phage(gi428783305) 3e-49 Click
4complement(4952884..4953153) putative excisionase; EcE22_2525 0.0 Click
5complement(4953215..4955686) PHAGE_Entero_mEp460: putative exonuclease; EcE22_2526; phage(gi428782342) 3e-58 Click
6complement(4955779..4955970) conserved hypothetical protein; EcE22_2527 0.0 Click
7complement(4955967..4956155) division inhibition protein DicB; EcE22_2528 0.0 Click
84956184..4956354 conserved hypothetical protein; EcE22_2529 0.0 Click
9complement(4956645..4956797) PHAGE_Salico_CGphi29: hypothetical protein; EcE22_2530; phage(gi472340166) 1e-08 Click
104957135..4957146 attL    AAGAGTTTTTAA 0.0 Click
114957694..4957909 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; EcE22_4010; phage(gi20065893) 5e-35 Click
124958226..4958633 PHAGE_Escher_P13374: hypothetical protein; EcE22_4011; phage(gi410491609) 1e-70 Click
134958635..4959390 PHAGE_Entero_HK106: hypothetical protein; EcE22_4012; phage(gi428783308) 2e-29 Click
144959401..4960198 PHAGE_Entero_P22: EaA; EcE22_4013; phage(gi9635497) 6e-65 Click
154960683..4960850 PHAGE_Entero_HK106: hypothetical protein; EcE22_4014; phage(gi428783307) 2e-27 Click
164961086..4962159 PHAGE_Entero_HK106: integrase; EcE22_4015; phage(gi428783305) 8e-154 Click
174962209..4962220 attR    AAGAGTTTTTAA 0.0 Click
184962284..4964998 PHAGE_Ectoca_1: EsV-1-65; EcE22_4016; phage(gi13242537) 5e-30 Click
194965070..4966143 4Fe-4S binding domain protein; EcE22_4017 0.0 Click
20complement(4966192..4966365) transcriptional regulator, GnsA/GnsB family; EcE22_4018 0.0 Click
21complement(4966759..4966971) PHAGE_Lactoc_bIL312: Csp; EcE22_4019; phage(gi13095918) 3e-18 Click
224967257..4967469 cold shock DNA-binding protein; EcE22_4020 0.0 Click
234967911..4968216 PHAGE_Equid__9: envelope glycoprotein J; EcE22_4021; phage(gi216905924) 1e-08 Click
244977071..4977083 attR    ATTGCCTGATGCG 0.0 Click

Region 14, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5075587..5077176) PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; EcE22_0264; phage(gi61806062) 3e-71 Click
25077294..5077416 hypothetical protein; EcE22_0265 0.0 Click
3complement(5078613..5079212) PHAGE_Entero_mEp460: Lom protein; EcE22_0007; phage(gi428782335) 4e-110 Click
4complement(5079283..5082696) PHAGE_Entero_mEp460: host specificity protein; EcE22_0008; phage(gi428782334) 0.0 Click
5complement(5082772..5082891) hypothetical protein; EcE22_0009 0.0 Click
6complement(5082937..5083518) PROPHAGE_Escher_Sakai: putative tail assembly protein; EcE22_0010; phage(gi15832199) 5e-97 Click
7complement(5084962..5085291) PROPHAGE_Escher_Sakai: putative minor tail protein; EcE22_0013; phage(gi15832202) 3e-60 Click
8complement(5085288..5087933) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; EcE22_0014; phage(gi15832203) 0.0 Click
9complement(5087977..5088261) PROPHAGE_Escher_Sakai: putative minor tail protein; EcE22_0015; phage(gi15832204) 1e-50 Click
10complement(5088312..5088734) PROPHAGE_Escher_Sakai: putative minor tail protein; EcE22_0016; phage(gi15832205) 8e-75 Click
11complement(5088748..5089500) PHAGE_Entero_HK630: major tail protein V; EcE22_0017; phage(gi428782800) 1e-112 Click
12complement(5089508..5089906) PROPHAGE_Escher_Sakai: putative minor tail protein U; EcE22_0018; phage(gi15832207) 1e-72 Click
13complement(5089919..5090542) PROPHAGE_Escher_Sakai: putative minor tail protein; EcE22_0019; phage(gi15832208) 6e-112 Click
14complement(5090545..5090793) PHAGE_Entero_mEp460: hypothetical protein; EcE22_0020; phage(gi428782323) 3e-18 Click
15complement(5090819..5091145) PHAGE_Entero_mEp460: hypothetical protein; EcE22_0021; phage(gi428782322) 2e-22 Click
16complement(5091233..5093188) PHAGE_Entero_mEp460: putative protease/scaffold protein; EcE22_0022; phage(gi428782321) 0.0 Click
17complement(5093202..5094704) PHAGE_Entero_mEp460: portal protein; EcE22_0023; phage(gi428782320) 0.0 Click
18complement(5094704..5094916) PHAGE_Entero_mEp460: hypothetical protein; EcE22_0024; phage(gi428782319) 2e-24 Click
19complement(5094913..5097036) PHAGE_Entero_mEp460: terminase large subunit; EcE22_0025; phage(gi428782318) 0.0 Click
20complement(5097033..5097509) PHAGE_Entero_mEp460: terminase small subunit; EcE22_0026; phage(gi428782317) 2e-46 Click
21complement(5097928..5098152) conserved hypothetical protein; EcE22_0027 0.0 Click
22complement(5098176..5098643) PHAGE_Entero_Sakai: Rz; EcE22_0028; phage(gi9633443) 3e-69 Click
23complement(5098640..5099173) PHAGE_Escher_TL_2011c: lysozyme; EcE22_0029; phage(gi418487070) 1e-101 Click
24complement(5099178..5099393) PHAGE_Stx2_c_II: holin; EcE22_0030; phage(gi302393164) 4e-35 Click
25complement(5099470..5099742) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF45; EcE22_0031; phage(gi157166030) 2e-43 Click
26complement(5102359..5102526) PHAGE_Entero_P1: TciB; EcE22_0034; phage(gi46401695) 3e-08 Click
27complement(5102523..5102954) PHAGE_Pseudo_AF: putative tellurite resistance protein; EcE22_0035; phage(gi431810338) 3e-30 Click

Region 15, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5247878..5248630) PHAGE_Entero_HK630: major tail protein V; EcE22_4632; phage(gi428782800) 9e-109 Click
2complement(5248638..5249033) PHAGE_Entero_HK630: minor tail protein U; EcE22_4633; phage(gi428782799) 2e-62 Click
3complement(5249030..5249605) PHAGE_Entero_HK630: minor tail protein Z; EcE22_4634; phage(gi428782798) 9e-59 Click
4complement(5249620..5249973) PHAGE_Entero_HK630: head-tail connector Fii; EcE22_4635; phage(gi428782797) 3e-43 Click
5complement(5249966..5250340) PHAGE_Entero_HK225: head assembly protein Fi; EcE22_4636; phage(gi428782384) 3e-07 Click
6complement(5250392..5251420) PHAGE_Entero_HK630: major head subunit E; EcE22_4637; phage(gi428782795) 1e-116 Click
7complement(5251478..5251825) PHAGE_Entero_HK630: head decoration protein D; EcE22_4638; phage(gi428782794) 6e-25 Click
85253998..5255935 PHAGE_Entero_4795: hypothetical protein YjhS; EcE22_4655; phage(gi157166028) 0.0 Click
95256083..5256265 PHAGE_Escher_P13374: hypothetical protein; EcE22_4656; phage(gi410491643) 3e-18 Click
105256303..5256572 PHAGE_Escher_P13374: hypothetical protein; EcE22_4657; phage(gi410491644) 2e-27 Click
115256657..5256863 PHAGE_Escher_P13374: lysis protein, holin; EcE22_4658; phage(gi410491645) 4e-33 Click
125256868..5257398 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; EcE22_4659; phage(gi116221997) 5e-60 Click
135257720..5258253 PHAGE_Entero_2008: putative endolysin; EcE22_4660; phage(gi209427769) 8e-101 Click
145258222..5258338 hypothetical protein; EcE22_4661 0.0 Click
155258445..5258591 conserved hypothetical protein; EcE22_4662 0.0 Click
165258743..5259210 PHAGE_Entero_4795: putative endopeptidase Rz; EcE22_4663; phage(gi157166036) 6e-69 Click
175259293..5259433 conserved hypothetical protein; EcE22_4664 0.0 Click
18complement(5260072..5260296) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EcE22_4665; phage(gi209427772) 2e-19 Click
195260444..5260569 conserved hypothetical protein; EcE22_4666 0.0 Click
205260691..5261200 PHAGE_Entero_HK630: terminase small subunit nu1; EcE22_4667; phage(gi428782788) 8e-18 Click
215261172..5263100 PHAGE_Entero_HK630: terminase large subunit A; EcE22_4668; phage(gi428782789) 0.0 Click
225263084..5263290 PHAGE_Entero_HK630: head-tail connector W; EcE22_4669; phage(gi428782790) 1e-11 Click
235264870..5266375 PHAGE_Entero_HK630: head maturation protease C; EcE22_4672; phage(gi428782792) 5e-108 Click