Burkholderia pseudomallei 1655 whole genome [asmbl_id: NC_000000].7029727, GC%: 68.00%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1612205..612247 attL    GCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG 0.0 Click
2complement(614636..614908) PHAGE_Burkho_phiE202: gp7, pANL12; PP_00661; phage(gi134288781) 2e-49 Click
3complement(614868..615140) PHAGE_Burkho_phiE202: gp6, pANL56; PP_00662; phage(gi134288760) 1e-47 Click
4complement(615247..616302) PHAGE_Burkho_phiE202: gp5, phage portal protein, pbsx family; PP_00663; phage(gi134288763) 0.0 Click
5complement(616299..618068) PHAGE_Burkho_phiE202: gp4, phage terminase, ATPase subunit; PP_00664; phage(gi134288784) 0.0 Click
6618212..619021 PHAGE_Burkho_phiE202: gp3, phage capsid scaffolding protein (GPO); PP_00665; phage(gi134288755) 2e-149 Click
7619055..620068 PHAGE_Burkho_phiE202: gp2, phage major capsid protein, P2 family; PP_00666; phage(gi134288740) 0.0 Click
8620065..620754 PHAGE_Burkho_phiE202: gp1, phage terminase, endonuclease subunit; PP_00667; phage(gi134288748) 8e-122 Click
9620854..621333 PHAGE_Burkho_phiE202: gp48, phage head completion protein (GPL); PP_00668; phage(gi134288751) 5e-85 Click
10621333..621584 PHAGE_Burkho_phiE202: gp47, hypothetical protein; PP_00669; phage(gi134288766) 7e-42 Click
11621581..621787 PHAGE_Burkho_phiE202: gp46, phage Tail Protein X; PP_00670; phage(gi134288782) 3e-33 Click
12621802..622146 PHAGE_Burkho_phiE202: gp45, putative bacteriophage membrane protein; PP_00671; phage(gi134288749) 4e-56 Click
13622148..622420 PHAGE_Burkho_phiE202: gp44, putative bacteriophage membrane protein; PP_00672; phage(gi134288752) 1e-44 Click
14622417..623229 PHAGE_Burkho_phiE202: gp43, bacteriophage-acquired protein; PP_00673; phage(gi134288769) 8e-151 Click
15623226..623666 PHAGE_Burkho_phiE202: gp42, protein LysB; PP_00674; phage(gi134288770) 1e-67 Click
16623620..623778 PHAGE_Burkho_phiE202: gp41, LysC; PP_00675; phage(gi134288745) 1e-24 Click
17623771..624187 PHAGE_Burkho_phiE202: gp40, P2 phage tail completion protein R (GpR); PP_00676; phage(gi134288754) 6e-74 Click
18624184..624651 PHAGE_Burkho_phiE202: gp39, phage virion morphogenesis protein; PP_00677; phage(gi134288746) 9e-79 Click
19complement(625659..626462) PHAGE_Burkho_phiE202: gp37, DNA methylase; PP_00678; phage(gi134288786) 7e-139 Click
20626603..627283 PHAGE_Burkho_phiE202: gp36, gpV; PP_00679; phage(gi134288750) 3e-126 Click
21627289..627642 PHAGE_Burkho_phiE202: gp35, phage baseplate assembly protein; PP_00680; phage(gi134288768) 3e-61 Click
22627639..628544 PHAGE_Burkho_phiE202: gp34, phage baseplate assembly protein; PP_00681; phage(gi134288785) 7e-167 Click
23628546..629091 PHAGE_Burkho_phiE202: gp33, phage tail protein I; PP_00682; phage(gi134288744) 1e-98 Click
24629102..631465 PHAGE_Burkho_phiE202: gp32, bacteriophage protein; PP_00683; phage(gi134288773) 0.0 Click
25631482..632153 PHAGE_Burkho_phiE202: gp31, bacteriophage-acquired protein; PP_00684; phage(gi134288758) 2e-132 Click
26632209..633381 PHAGE_Burkho_phiE202: gp30, phage tail sheath protein; PP_00685; phage(gi134288772) 0.0 Click
27633403..633906 PHAGE_Burkho_phiE202: gp29, phage major tail tube protein; PP_00686; phage(gi134288759) 5e-94 Click
28633964..634308 PHAGE_Burkho_phiE202: gp28, phage tail protein E; PP_00687; phage(gi134288780) 8e-59 Click
29634317..634430 PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; PP_00688; phage(gi134288776) 1e-15 Click
30634433..637393 PHAGE_Burkho_phiE202: gp26, bacteriophage membrane protein; PP_00689; phage(gi134288775) 0.0 Click
31637417..637836 PHAGE_Burkho_phiE202: gp25, fels-2 prophage protein; PP_00690; phage(gi134288777) 2e-74 Click
32637836..638933 PHAGE_Burkho_phiE202: gp24, fels-2 prophage protein; PP_00691; phage(gi134288767) 0.0 Click
33complement(638941..639441) PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p34; PP_00692; phage(gi109289969) 7e-06 Click
34639487..639627 hypothetical; PP_00693 0.0 Click
35complement(640286..640621) PHAGE_Burkho_phiE202: gp21; PP_00694; phage(gi134288765) 5e-17 Click
36640828..641064 PHAGE_Burkho_phiE202: gp20, conserved hypothetical protein; PP_00695; phage(gi134288764) 1e-32 Click
37641200..641364 PHAGE_Burkho_KS5: gp9; PP_00696; phage(gi327198007) 2e-16 Click
38641352..641600 PHAGE_Burkho_phiE202: gp19, conserved hypothetical protein; PP_00697; phage(gi134288771) 2e-42 Click
39641686..642231 PHAGE_Burkho_phi52237: hypothetical protein BPSphi5223_0012; PP_00698; phage(gi72537688) 3e-99 Click
40642247..642465 PHAGE_Burkho_phiE202: gp18, conserved hypothetical protein; PP_00699; phage(gi134288761) 3e-31 Click
41642471..642668 PHAGE_Burkho_phiE202: gp17, conserved hypothetical protein; PP_00700; phage(gi134288774) 1e-31 Click
42642712..642906 PHAGE_Burkho_phiE202: gp16, conserved hypothetical protein; PP_00701; phage(gi134288756) 4e-30 Click
43642910..643149 PHAGE_Burkho_phiE202: gp15, conserved hypothetical protein; PP_00702; phage(gi134288742) 1e-37 Click
44643318..643524 PHAGE_Burkho_phiE202: gp14, conserved hypothetical protein; PP_00703; phage(gi134288778) 3e-36 Click
45643527..643886 PHAGE_Burkho_phiE202: gp13, conserved hypothetical protein; PP_00704; phage(gi134288783) 3e-64 Click
46643883..644137 PHAGE_Burkho_phiE202: gp12, hypothetical protein; PP_00705; phage(gi134288787) 4e-42 Click
47644149..646941 PHAGE_Burkho_phiE202: gp11, conserved hypothetical protein; PP_00706; phage(gi134288779) 0.0 Click
48647831..648940 PHAGE_Burkho_phiE202: gp10, site-specific recombinase, phage integrase family; PP_00707; phage(gi134288747) 5e-80 Click
49complement(649006..649081) tRNA 0.0 Click
50649008..649050 attR    GCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG 0.0 Click
51649430..650257 PHAGE_Cronob_ESP2949_1: tail fiber; PP_00708; phage(gi422935481) 3e-06 Click

Region 2, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12223747..2223759 attL    CCGCCGCCGGACG 0.0 Click
2complement(2228624..2229607) PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; PP_02293; phage(gi169257204) 6e-05 Click
3complement(2229607..2230677) PROPHAGE_Escher_MG1655: DNA strand exchange and recombination protein with protease and nuclease activity; PP_02294; phage(gi16130606) 2e-131 Click
42230872..2231624 PHAGE_Ectoca_1: EsV-1-65; PP_02295; phage(gi13242537) 5e-06 Click
52231648..2233204 PHAGE_Ectoca_1: EsV-1-65; PP_02296; phage(gi13242537) 5e-12 Click
62233427..2235085 PHAGE_Burkho_phi1026b: gp59; PP_02297; phage(gi38707949) 3e-46 Click
72235091..2235225 hypothetical protein BURPS668_0806 [Burkholderia pseudomallei 668] gi|126438614|ref|YP_001057857.1|; PP_02298 7e-18 Click
82235157..2235169 attR    CCGCCGCCGGACG 0.0 Click
92235327..2235403 tRNA 0.0 Click
102235485..2236804 PROPHAGE_Escher_Sakai: putative integrase; PP_02299; phage(gi15834496) 6e-22 Click

Region 3, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13683138..3685342 PHAGE_Entero_01: Putative tail fiber protein; PP_03799; phage(gi38707850) 7e-05 Click
23685385..3686068 hypothetical protein BMASAVP1_1608 [Burkholderia mallei SAVP1] gi|121596656|ref|YP_991202.1|; PP_03800 3e-115 Click
33686028..3687875 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; PP_03801; phage(gi17546158) 7e-21 Click
43688136..3688843 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; PP_03802; phage(gi17546158) 4e-66 Click
5complement(3689321..3690580) PHAGE_Cronob_vB_CsaM_GAP31: putative tail fiber protein; PP_03803; phage(gi414086879) 6e-06 Click
63690679..3690828 hypothetical; PP_03804 0.0 Click
73691099..3691392 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; PP_03805; phage(gi24373865) 2e-10 Click
83691389..3692279 PROPHAGE_Escher_CFT073: transposase insF; PP_03806; phage(gi26249410) 5e-63 Click

Region 4, total : 6 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13818093..3818620 PROPHAGE_Escher_Sakai: ClpXP protease specificity-enhancing factor; PP_03947; phage(gi15833355) 2e-24 Click
23818641..3818716 tRNA 0.0 Click
33818672..3818710 attL    TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG 0.0 Click
4complement(3818793..3819032) PHAGE_Xylell_Xfas53: integrase; PP_03948; phage(gi273810420) 2e-08 Click
53819025..3819339 PHAGE_Burkho_2: gp4, phage terminase, ATPase subunit; PP_03949; phage(gi134288710) 1e-55 Click
63819336..3820391 PHAGE_Burkho_2: gp5, phage portal protein, pbsx family; PP_03950; phage(gi134288732) 0.0 Click
7complement(3820435..3820797) PHAGE_Burkho_2: gp6, putative addiction module antidote protein; PP_03951; phage(gi134288715) 4e-60 Click
8complement(3820794..3821108) PHAGE_Burkho_2: gp7, putative addiction module killer protein; PP_03953; phage(gi134288691) 4e-54 Click
93823758..3823796 attR    TTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG 0.0 Click

Region 5, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14829171..4830148 PHAGE_Lactoc_P087: putative cysteine synthase; PP_05017; phage(gi229605000) 2e-34 Click
24830253..4830738 prolyl-tRNA synthetase [Burkholderia mallei SAVP1] gi|121596696|ref|YP_989635.1|; PP_05019 8e-88 Click
3complement(4831366..4832034) isochorismatase [Pectobacterium atrosepticum SCRI1043] gi|50121311|ref|YP_050478.1|; PP_05020 2e-92 Click
44832329..4832634 HxlR family transcriptional regulator [Methanosaeta concilii GP6] gi|330508362|ref|YP_004384790.1|; PP_05021 4e-12 Click
5complement(4832717..4833007) PROPHAGE_Escher_CFT073: transposase IS629; PP_05022; phage(gi26250986) 1e-06 Click
64833154..4833414 PROPHAGE_Xantho_33913: IS1477 transposase; PP_05023; phage(gi21230912) 3e-23 Click
74833472..4833678 PHAGE_Burkho_2: gp7, putative addiction module killer protein; PP_05024; phage(gi134288691) 1e-30 Click
84833681..4834037 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; PP_05025; phage(gi134288715) 4e-60 Click
9complement(4834081..4834230) PHAGE_Burkho_2: gp5, phage portal protein, pbsx family; PP_05026; phage(gi134288732) 5e-09 Click