Wolbachia endosymbiont of Drosophila ananassae gdan_438, whole [asmbl_id: NC_000000].1440750, GC%: 35.71%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
191241..91252 attL    ATGAGAAAAAAG 0.0 Click
296718..97293 PHAGE_Clostr_phiCD6356: putative phage tail tape measure protein; WwAna1225; phage(gi326536862) 1e-05 Click
397385..97948 PHAGE_Helico_2: methyltransferase; WwAna1226; phage(gi370703039) 2e-07 Click
498736..99194 PHAGE_Fowlpo_virus: Ankyrin repeat gene family protein; WwAna1227; phage(gi9634704) 2e-05 Click
599277..100830 PHAGE_Acanth_mimivirus: putative ankyrin repeat protein; WwAna1228; phage(gi311977464) 3e-17 Click
6101194..101505 conserved hypothetical protein; WwAna1229 0.0 Click
7101642..101881 uncharacterized phage protein, putative; WwAna1230 0.0 Click
8complement(101897..102892) PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; WwAna1231; phage(gi160688404) 2e-10 Click
9103025..103222 uncharacterized phage protein, putative; WwAna1232 0.0 Click
10103521..103931 conserved hypothetical protein; WwAna1233 0.0 Click
11103906..104295 conserved hypothetical protein; WwAna1234 0.0 Click
12104331..105146 PHAGE_Staphy_SA11: hypothetical protein; WwAna1235; phage(gi422935722) 3e-05 Click
13106099..106479 PROPHAGE_Shewan_MR-1: ISSod6, transposase; WwAna1236; phage(gi24374783) 2e-08 Click
14106590..106931 PROPHAGE_Xantho_33913: IS1480 transposase; WwAna1237; phage(gi21231089) 4e-09 Click
15complement(107491..107979) ISSod10, transposase OrfA, putative; WwAna1238 0.0 Click
16108249..108584 PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; WwAna1239; phage(gi428782737) 4e-30 Click
17108587..109348 PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; WwAna1240; phage(gi29143752) 1e-30 Click
18109302..109397 hypothetical protein; WwAna1241 0.0 Click
19109397..110551 conserved hypothetical protein; WwAna1242 0.0 Click
20110719..111531 PHAGE_Canary_virus: CNPV223 ankyrin repeat protein; WwAna1243; phage(gi40556161) 5e-27 Click
21111746..112027 hypothetical protein; WwAna1244 0.0 Click
22111803..111814 attR    ATGAGAAAAAAG 0.0 Click
23112182..113657 PHAGE_Lister_A118: putative integrase; WwAna1245; phage(gi16798814) 2e-15 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1572691..573236 PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; WwAna1752; phage(gi26989833) 3e-09 Click
2573794..575215 glutamyl-tRNA(Gln) amidotransferase, B subunit; WwAna1753 0.0 Click
3575227..578511 PHAGE_Canary_virus: CNPV223 ankyrin repeat protein; WwAna1754; phage(gi40556161) 8e-40 Click
4complement(579022..579260) cysteinyl-tRNA synthetase; WwAna1755 0.0 Click
5complement(579357..580013) PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; WwAna1170; phage(gi29143752) 3e-33 Click
6complement(580023..580349) PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; WwAna1171; phage(gi428782737) 3e-29 Click
7complement(580364..580618) PHAGE_Campyl_NCTC12673: Probable gp5.4 conserved hypothetical protein; WwAna1172; phage(gi332672343) 5e-09 Click
8complement(580627..581082) PHAGE_Salmon_RE_2010: baseplate assembly protein V; WwAna1173; phage(gi418489709) 4e-20 Click
9complement(581069..581542) PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; WwAna1174; phage(gi428782734) 3e-07 Click
10complement(581523..582020) PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; WwAna1175; phage(gi428782733) 2e-11 Click
11complement(582013..582279) conserved hypothetical protein; WwAna1176 0.0 Click
12582328..582624 hypothetical protein; WwAna1177 0.0 Click
13complement(582417..583421) PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; WwAna1178; phage(gi428782731) 4e-86 Click
14583171..583347 hypothetical protein; WwAna1179 0.0 Click
15complement(583447..583818) PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; WwAna1180; phage(gi428782730) 3e-06 Click
16complement(583886..584923) PHAGE_Burkho_phiE125: putative capsid assembly protein/protease; WwAna1181; phage(gi17975166) 5e-50 Click
17complement(584920..586341) PHAGE_Vibrio_vB_VpaM_MAR: portal protein; WwAna1182; phage(gi428782728) 5e-100 Click
18complement(586341..587399) Hypothetical cytosolic protein, putative; WwAna1183 0.0 Click
19complement(587399..587623) conserved hypothetical protein; WwAna1184 0.0 Click
20complement(587625..588365) PHAGE_Entero_mEp237: terminase large subunit A; WwAna1185; phage(gi435439267) 3e-25 Click

Region 3, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1987462..987932 PHAGE_Tetras_SI1: hypothetical protein; WwAna0305; phage(gi472342269) 2e-05 Click
2988077..988547 conserved hypothetical protein; WwAna0306 0.0 Click
3988567..988935 PHAGE_Canary_virus: CNPV151 ankyrin repeat protein; WwAna0307; phage(gi40556089) 1e-05 Click
4989065..989169 hypothetical protein; WwAna0851 0.0 Click
5complement(989311..989706) PHAGE_Atlant_virus: polyprotein; WwAna0852; phage(gi83722645) 9e-05 Click
6complement(989706..991016) PHAGE_Melano_entomopoxvirus: ORF MSV027 tryptophan repeat gene family protein; WwAna0853; phage(gi9631532) 4e-07 Click
7complement(991538..991840) tRNA pseudouridine synthase A; WwAna1019 0.0 Click
8complement(991882..992034) conserved hypothetical protein; WwAna1020 0.0 Click
9992069..992170 transposase, IS5 family, truncation; WwAna1021 0.0 Click
10complement(992309..993327) ubiquinol-cytochrome c reductase, cytochrome c1; WwAna1022 0.0 Click
11993336..993530 PROPHAGE_Xylell_Temecula1: phage-related tail protein; WwAna0161; phage(gi28198980) 2e-06 Click
12complement(993496..994032) PHAGE_Canary_virus: CNPV294 ankyrin repeat protein; WwAna0162; phage(gi40556232) 1e-13 Click

Region 4, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11013868..1013895 attL    ACCACGGGGCTTCTTTTGCCTTTTTTTT 0.0 Click
2complement(1020868..1021471) PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; WwAna0148; phage(gi26989833) 3e-09 Click
31023338..1023688 CBS domain protein; WwAna0643 0.0 Click
41023702..1024007 PHAGE_Azospi_Cd: hypothetical protein APCd_gp10; WwAna0644; phage(gi168495113) 1e-17 Click
5complement(1024399..1025142) virB9 protein precursor; WwAna0645 0.0 Click
61025205..1026092 PHAGE_Vibrio_VP882: phage-related tail protein; WwAna0421; phage(gi126010872) 1e-10 Click
71026096..1026512 PROPHAGE_Xylell_Temecula1: phage-related tail protein; WwAna0422; phage(gi28198982) 6e-19 Click
81026487..1026696 PHAGE_Salmon_RE_2010: tail component protein; WwAna0423; phage(gi418489702) 1e-11 Click
91026698..1027006 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; WwAna0424; phage(gi428782753) 4e-18 Click
101027237..1028427 PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; WwAna1631; phage(gi26989833) 1e-09 Click
11complement(1028470..1028918) PHAGE_Caulob_CcrColossus: putative tRNA nucleotidyl transferase; WwAna1632; phage(gi414088345) 3e-05 Click
12complement(1029392..1029499) hypothetical protein; WwAna0368 0.0 Click
13complement(1029558..1030634) PHAGE_Entero_phiFL3A: integrase; WwAna0369; phage(gi281416214) 5e-16 Click
14complement(1030770..1031838) threonyl-tRNA synthetase; WwAna0040 0.0 Click
15complement(1031835..1032026) conserved hypothetical protein; WwAna0041 0.0 Click
16complement(1032142..1032611) NADH dehydrogenase I, I subunit; WwAna0042 0.0 Click
171033592..1034335 PHAGE_Feline_virus: Gag-Pro-Pol precursor polyprotein gPr80; WwAna0218; phage(gi9630708) 7e-05 Click
181049263..1049290 attR    ACCACGGGGCTTCTTTTGCCTTTTTTTT 0.0 Click

Region 5, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1138838..1139233) PHAGE_Feline_virus: Gag-Pro-Pol precursor polyprotein gPr80; WwAna0444; phage(gi9630708) 9e-05 Click
2complement(1139211..1139690) PHAGE_Melano_entomopoxvirus: ORF MSV027 tryptophan repeat gene family protein; WwAna0445; phage(gi9631532) 6e-08 Click
31139903..1140028 hypothetical protein; WwAna0446 0.0 Click
41140146..1140591 conserved hypothetical protein; WwAna0028 0.0 Click
5complement(1140816..1141403) PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; WwAna0029; phage(gi26989833) 3e-09 Click
6complement(1141578..1142320) PHAGE_Fowlpo_virus: Ankyrin repeat gene family protein; WwAna0471; phage(gi9634694) 5e-08 Click
71142417..1142809 excinuclease ABC, B subunit; WwAna0472 0.0 Click
8complement(1143024..1143515) PHAGE_Vibrio_vB_VpaM_MAR: portal protein; WwAna0371; phage(gi428782728) 7e-24 Click
9complement(1143664..1144008) PHAGE_Mannhe_phiMHaA1: baseplate assembly protein V; WwAna0372; phage(gi109289954) 4e-14 Click
10complement(1143995..1144171) conserved hypothetical protein; WwAna0373 0.0 Click
111144515..1144889 conserved hypothetical protein; WwAna0478 0.0 Click
12complement(1144865..1145020) pyruvate dehydrogenase E1 beta subunit; WwAna0479 0.0 Click
131145226..1145762 PHAGE_Shrimp_virus: wsv091; WwAna0480; phage(gi17158195) 4e-05 Click
141145868..1146900 PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; WwAna0035; phage(gi26989833) 7e-09 Click