Xylella fastidiosa Dixon whole genome shotgun sequence. [asmbl_id: NC_000000].2622328, GC%: 52.03%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1294729..294740 attL    AAAAAATAAATA 0.0 Click
2294797..294810 attL    ATTAAATATTATAT 0.0 Click
3307439..308512 PHAGE_Burkho_DC1: integrase; XfasaDRAFT_1969; phage(gi401723020) 2e-60 Click
4308595..308608 attR    ATTAAATATTATAT 0.0 Click
5308852..308947 conserved hypothetical protein; XfasaDRAFT_2322 0.0 Click
6309186..309440 PHAGE_Azospi_Cd: Helix-turn-helix motif; XfasaDRAFT_1970; phage(gi168495160) 5e-08 Click
7309539..310528 PHAGE_Entero_RB43: hypothetical protein RB43ORF127c; XfasaDRAFT_1971; phage(gi66391578) 6e-24 Click
8310528..311391 hypothetical protein; XfasaDRAFT_1972 0.0 Click
9complement(311654..312262) PHAGE_Stenot_S1: putative methylase; XfasaDRAFT_1973; phage(gi213163922) 7e-33 Click
10complement(312259..312954) conserved hypothetical protein; XfasaDRAFT_1974 0.0 Click
11complement(313030..313449) conserved hypothetical protein; XfasaDRAFT_1975 0.0 Click
12complement(313453..313965) PHAGE_Synech_S_CBS3: fiber protein; XfasaDRAFT_1976; phage(gi331028026) 1e-11 Click
13complement(313958..316444) PHAGE_Pseudo_B3: hypothetical protein B3ORF56; XfasaDRAFT_1977; phage(gi56692625) 2e-74 Click
14316429..316950 PHAGE_Bordet_1: adenine DNA methyltransferase; XfasaDRAFT_1978; phage(gi41179391) 3e-33 Click
15317050..317292 PHAGE_Pseudo_PA11: hypothetical protein ORF033; XfasaDRAFT_1979; phage(gi149408192) 2e-08 Click
16317302..317544 PHAGE_Acinet_AP22: putative endolysin/autolysin; XfasaDRAFT_1980; phage(gi388570824) 2e-15 Click
17317537..317851 conserved hypothetical protein; XfasaDRAFT_1981 0.0 Click
18317853..318206 conserved hypothetical protein; XfasaDRAFT_1982 0.0 Click
19319189..320607 PHAGE_Xylell_Xfas53: TerL; XfasaDRAFT_1983; phage(gi273810450) 0.0 Click
20320610..322631 PHAGE_Xylell_Xfas53: portal protein; XfasaDRAFT_1984; phage(gi273810451) 0.0 Click
21322651..323508 PHAGE_Xylell_Xfas53: scaffold protein; XfasaDRAFT_1985; phage(gi273810452) 2e-75 Click
22323546..324775 PHAGE_Xylell_Xfas53: capsid protein; XfasaDRAFT_1986; phage(gi273810453) 3e-170 Click
23324779..325186 PHAGE_Xylell_Xfas53: DNA stabilization protein; XfasaDRAFT_1987; phage(gi273810454) 3e-35 Click
24325183..326850 PHAGE_Xylell_Xfas53: head completion protein; XfasaDRAFT_1988; phage(gi273810455) 2e-179 Click
25326820..327065 PHAGE_Xylell_Xfas53: gp37; XfasaDRAFT_2323; phage(gi273810456) 5e-30 Click
26327115..327870 PHAGE_Xylell_Xfas53: DNA injection protein; XfasaDRAFT_1989; phage(gi273810457) 9e-85 Click
27327874..329085 PHAGE_Xylell_Xfas53: DNA injection protein; XfasaDRAFT_1990; phage(gi273810458) 3e-127 Click
28329085..329915 PHAGE_Xylell_Xfas53: DNA injection protein; XfasaDRAFT_1991; phage(gi273810459) 3e-95 Click
29329905..330789 PHAGE_Xylell_Xfas53: DNA injection protein; XfasaDRAFT_1992; phage(gi273810459) 4e-87 Click
30330823..331605 PHAGE_Xylell_Xfas53: gp44; XfasaDRAFT_1993; phage(gi273810463) 6e-105 Click
31331602..331955 PHAGE_Xylell_Xfas53: gp45; XfasaDRAFT_2272; phage(gi273810464) 6e-26 Click
32332195..332737 Fimbrial protein pilin; XfasaDRAFT_1994 0.0 Click
33complement(332834..333355) PHAGE_Rhodov_RS1: hypothetical protein; XfasaDRAFT_1995; phage(gi472342911) 2e-13 Click
34333582..334601 PHAGE_Xylell_Xfas53: integrase; XfasaDRAFT_1996; phage(gi273810420) 5e-175 Click
35347000..347011 attR    AAAAAATAAATA 0.0 Click

Region 2, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1592510..592521 attL    ACTCAAACACGC 0.0 Click
2595235..595552 PHAGE_Burkho_phiE202: gp7, pANL12; XfasaDRAFT_2342; phage(gi134288781) 1e-06 Click
3596560..596859 conserved hypothetical protein; XfasaDRAFT_2343 0.0 Click
4complement(597578..598255) PHAGE_Stenot_S1: putative methylase; XfasaDRAFT_2194; phage(gi213163922) 7e-83 Click
5complement(598289..599485) PHAGE_Microc_LMM01: transposase; XfasaDRAFT_2195; phage(gi117530306) 1e-72 Click
6complement(599479..600126) PHAGE_Microc_LMM01: putative site-specific integrase-resolvase; XfasaDRAFT_2196; phage(gi117530307) 2e-65 Click
7complement(600150..600554) hypothetical protein; XfasaDRAFT_2280 0.0 Click
8complement(600500..601195) conserved hypothetical protein; XfasaDRAFT_2197 0.0 Click
9complement(601271..601690) conserved hypothetical protein; XfasaDRAFT_2198 0.0 Click
10complement(601694..602206) PHAGE_Synech_S_CBS1: fibre protein; XfasaDRAFT_2199; phage(gi356870814) 2e-10 Click
11complement(602199..605024) PHAGE_Pseudo_B3: hypothetical protein B3ORF56; XfasaDRAFT_2200; phage(gi56692625) 2e-74 Click
12complement(605014..605250) PHAGE_Pseudo_JBD24: hypothetical protein; XfasaDRAFT_2201; phage(gi448245099) 5e-13 Click
13complement(605247..605675) PHAGE_Pseudo_MP1412: tail assembly structural protein; XfasaDRAFT_2202; phage(gi399529036) 7e-07 Click
14605857..606132 hypothetical protein; XfasaDRAFT_2344 0.0 Click
15complement(606209..606724) PHAGE_Salmon_1: putative bacteriophage portal protein; XfasaDRAFT_2203; phage(gi169257187) 7e-19 Click
16complement(606721..607095) hypothetical protein; XfasaDRAFT_2204 0.0 Click
17complement(607034..607792) PHAGE_Stenot_S1: putative terminase large subunit; XfasaDRAFT_2205; phage(gi213163902) 2e-08 Click
18608101..608502 hypothetical protein; XfasaDRAFT_2276 0.0 Click
19complement(608604..609227) PHAGE_Vibrio_VHML: ORF7; XfasaDRAFT_2206; phage(gi27311230) 1e-08 Click
20609181..609714 hypothetical protein; XfasaDRAFT_2277 0.0 Click
21610172..610630 conserved hypothetical protein; XfasaDRAFT_2278 0.0 Click
22610844..610855 attL    CATGAACATCAA 0.0 Click
23610845..611123 hypothetical protein; XfasaDRAFT_2207 0.0 Click
24611120..611386 conserved hypothetical protein; XfasaDRAFT_2279 0.0 Click
25611519..612052 fimbrillin; XfasaDRAFT_2208 0.0 Click
26612145..612738 PHAGE_Aeromo_phiAS5: hypothetical protein; XfasaDRAFT_2209; phage(gi310722663) 3e-08 Click
27612735..613268 PHAGE_Pseudo_F116: hypothetical protein F116p07; XfasaDRAFT_2210; phage(gi56692934) 3e-28 Click
28613265..613498 conserved hypothetical protein; XfasaDRAFT_2345 0.0 Click
29613873..614391 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; XfasaDRAFT_2211; phage(gi56692915) 2e-36 Click
30614413..614685 conserved hypothetical protein; XfasaDRAFT_2212 0.0 Click
31614685..615857 PROPHAGE_Xylell_Temecula1: phage-related integrase; XfasaDRAFT_2213; phage(gi28198969) 0.0 Click
32617426..617437 attR    CATGAACATCAA 0.0 Click
33627961..627972 attR    ACTCAAACACGC 0.0 Click

Region 3, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(679863..680018) PHAGE_Synech_S_SKS1: DNA methylase; XfasaDRAFT_2255; phage(gi472341043) 9e-05 Click
2680531..680606 tRNA 0.0 Click
3680558..680593 attL    CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCA 0.0 Click
4681059..681364 hypothetical protein; XfasaDRAFT_2358 0.0 Click
5681616..681798 conserved hypothetical protein; XfasaDRAFT_2256 0.0 Click
6681921..682262 conserved hypothetical protein; XfasaDRAFT_2359 0.0 Click
7682295..683470 PHAGE_Stenot_phiSMA9: phage replication protein; XfasaDRAFT_2257; phage(gi70727679) 4e-77 Click
8683520..683822 PHAGE_Stenot_phiSMA9: hypothetical protein phiSMA9p7; XfasaDRAFT_2258; phage(gi70727685) 3e-10 Click
9684218..684346 phage-related protein; XfasaDRAFT_2360 0.0 Click
10684475..685764 PHAGE_Stenot_phiSMA9: hypothetical protein phiSMA9p6; XfasaDRAFT_2259; phage(gi70727684) 2e-23 Click
11685765..686106 PHAGE_Stenot_phiSMA9: hypothetical protein phiSMA9p5; XfasaDRAFT_2361; phage(gi70727683) 2e-21 Click
12686106..687440 PHAGE_Stenot_phiSMA9: putative zonula occludens toxin; XfasaDRAFT_2260; phage(gi70727682) 4e-117 Click
13complement(687602..687907) conserved hypothetical protein; XfasaDRAFT_2261 0.0 Click
14688176..689006 PHAGE_Aggreg_S1249: putative integrase; XfasaDRAFT_2262; phage(gi273809608) 3e-64 Click
15689023..689058 attR    CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCA 0.0 Click

Region 4, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11161594..1162469 PHAGE_Amsact_: putative ATP-binding cassette transporter; XfasaDRAFT_1124; phage(gi9964444) 3e-14 Click
21162466..1163434 putative ABC-2 type transport system permease protein; XfasaDRAFT_1125 0.0 Click
31163693..1164139 conserved hypothetical protein; XfasaDRAFT_1126 0.0 Click
4complement(1164243..1165487) PHAGE_Pectob_ZF40: putative tail-fiber protein; XfasaDRAFT_1127; phage(gi422936707) 5e-29 Click
5complement(1165491..1166051) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p49; XfasaDRAFT_1128; phage(gi31544052) 2e-33 Click
6complement(1166048..1167193) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p48; XfasaDRAFT_1129; phage(gi31544051) 5e-98 Click
71166683..1166695 attL    TGGTGATGGCCCG 0.0 Click
8complement(1167286..1167639) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p47; XfasaDRAFT_1130; phage(gi31544050) 1e-27 Click
9complement(1167636..1168277) PHAGE_Haemop_Aaphi23: putative baseplate protein; XfasaDRAFT_1131; phage(gi31544048) 5e-32 Click
10complement(1168274..1169104) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p45; XfasaDRAFT_1132; phage(gi31544047) 5e-78 Click
11complement(1169101..1169418) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p44; XfasaDRAFT_1133; phage(gi44829138) 2e-21 Click
12complement(1169418..1170188) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p43; XfasaDRAFT_1134; phage(gi31544045) 2e-39 Click
131170165..1170575 PHAGE_Burkho_2: gp7, putative addiction module killer protein; XfasaDRAFT_1241; phage(gi134288691) 2e-17 Click
141170579..1170887 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; XfasaDRAFT_1135; phage(gi134288715) 8e-20 Click
15complement(1170961..1172850) PHAGE_Haemop_Aaphi23: putative tail length tape measure protein; XfasaDRAFT_1136; phage(gi31544043) 2e-52 Click
16complement(1172998..1173420) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p41; XfasaDRAFT_1137; phage(gi31544042) 4e-21 Click
17complement(1173417..1173854) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p40; XfasaDRAFT_1138; phage(gi31544041) 2e-45 Click
18complement(1173864..1175360) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p39; XfasaDRAFT_1139; phage(gi31544040) 4e-128 Click
19complement(1175361..1175894) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p38; XfasaDRAFT_1140; phage(gi31544039) 7e-18 Click
20complement(1175818..1176198) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p37a; XfasaDRAFT_1242; phage(gi31544038) 4e-20 Click
21complement(1176173..1176652) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p37; XfasaDRAFT_1141; phage(gi31544037) 2e-12 Click
22complement(1176649..1177020) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p36; XfasaDRAFT_1142; phage(gi31544036) 1e-16 Click
23complement(1177023..1177358) conserved hypothetical protein; XfasaDRAFT_1143 0.0 Click
24complement(1177421..1178398) PHAGE_Vibrio_vB_VchM_138: putative major capsid protein; XfasaDRAFT_1144; phage(gi422936575) 1e-35 Click
25complement(1178414..1178896) PHAGE_Iodoba_phiPLPE: hypothetical protein phiPLPE_28; XfasaDRAFT_1145; phage(gi197085642) 1e-05 Click
26complement(1178906..1180204) PHAGE_Pectob_ZF40: putative head protein; XfasaDRAFT_1146; phage(gi422936684) 6e-43 Click
27complement(1180114..1180959) PHAGE_Haemop_Aaphi23: putative minor head protein; XfasaDRAFT_1147; phage(gi31544030) 2e-34 Click
281181032..1181370 PHAGE_Klebsi_phiKO2: Gp49; XfasaDRAFT_1148; phage(gi46402135) 3e-06 Click
291181367..1181648 PHAGE_Pseudo_phiKZ: ORF114; XfasaDRAFT_1149; phage(gi29135050) 7e-16 Click
30complement(1181697..1183085) PHAGE_Vibrio_vB_VchM_138: putative portal protein; XfasaDRAFT_1150; phage(gi422936563) 4e-72 Click
31complement(1183082..1184632) PHAGE_Vibrio_CP_T1: putative TerL large-subunit terminase; XfasaDRAFT_1151; phage(gi418489210) 1e-110 Click
32complement(1184583..1184981) conserved hypothetical protein; XfasaDRAFT_1152 0.0 Click
33complement(1185073..1185285) conserved hypothetical protein; XfasaDRAFT_1243 0.0 Click
34complement(1185287..1185748) conserved hypothetical protein; XfasaDRAFT_1153 0.0 Click
35complement(1185738..1186067) conserved hypothetical protein; XfasaDRAFT_1154 0.0 Click
36complement(1186060..1186560) PHAGE_Pseudo_PA11: hypothetical protein ORF033; XfasaDRAFT_1155; phage(gi149408192) 6e-28 Click
37complement(1186660..1187391) PHAGE_Bordet_1: adenine DNA methyltransferase; XfasaDRAFT_1156; phage(gi41179391) 1e-52 Click
38complement(1187581..1187916) PHAGE_Entero_mEp234: HicB protein; XfasaDRAFT_1157; phage(gi428782291) 2e-07 Click
39complement(1188220..1188942) PHAGE_Xylell_Xfas53: gp24; XfasaDRAFT_1158; phage(gi273810443) 3e-110 Click
401189420..1190688 PHAGE_Xylell_Xfas53: DNA polymerase A; XfasaDRAFT_1159; phage(gi273810426) 0.0 Click
411190685..1190963 PHAGE_Xylell_Xfas53: putative nuclease; XfasaDRAFT_1160; phage(gi273810425) 2e-46 Click
42complement(1190965..1191369) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0029; XfasaDRAFT_1161; phage(gi89886010) 1e-04 Click
431191454..1192872 PHAGE_Xylell_Xfas53: helicase; XfasaDRAFT_1162; phage(gi273810423) 0.0 Click
441192760..1192772 attR    TGGTGATGGCCCG 0.0 Click
451193114..1194133 PHAGE_Xylell_Xfas53: integrase; XfasaDRAFT_1163; phage(gi273810420) 0.0 Click

Region 5, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1303679..1304449) PHAGE_Xylell_Xfas53: CI phage repressor; XfasaDRAFT_1252; phage(gi273810436) 4e-35 Click
21304487..1304723 hypothetical protein; XfasaDRAFT_1413 0.0 Click
31304991..1305179 PHAGE_Burkho_KL3: gp11; XfasaDRAFT_1253; phage(gi327198056) 8e-07 Click
41305176..1305424 conserved hypothetical protein; XfasaDRAFT_1414 0.0 Click
51305702..1306310 PHAGE_Xylell_Xfas53: Bro-N family protein; XfasaDRAFT_1254; phage(gi273810441) 2e-48 Click
61306447..1308978 PHAGE_Xylell_Xfas53: P4 family phage/plasmid primase; XfasaDRAFT_1255; phage(gi273810442) 0.0 Click
71309371..1310015 PHAGE_Burkho_KS10: hypothetical protein KS10_gp27; XfasaDRAFT_1415; phage(gi198449289) 3e-05 Click
81309955..1310449 PHAGE_Acinet_AP22: putative endolysin/autolysin; XfasaDRAFT_1256; phage(gi388570824) 3e-28 Click
91310442..1310771 PHAGE_Burkho_BcepNY3: holin; XfasaDRAFT_1257; phage(gi149882929) 4e-08 Click
101310761..1311222 conserved hypothetical protein; XfasaDRAFT_1258 0.0 Click
111311224..1311448 conserved hypothetical protein; XfasaDRAFT_1416 0.0 Click
121311579..1312154 PHAGE_Entero_mEp237: terminase small subunit nu1; XfasaDRAFT_1259; phage(gi435439266) 1e-10 Click
131312147..1314099 PHAGE_Vibrio_vB_VpaM_MAR: terminase large subunit; XfasaDRAFT_1260; phage(gi428782726) 3e-47 Click
141314103..1314654 PHAGE_Vibrio_VP882: putative phage-related protein; XfasaDRAFT_1261; phage(gi126010851) 4e-26 Click
151314651..1316237 PHAGE_Vibrio_vB_VpaM_MAR: portal protein; XfasaDRAFT_1262; phage(gi428782728) 4e-27 Click
161316234..1318108 PHAGE_Synech_S_CBS3: major capsid protein; XfasaDRAFT_1263; phage(gi331028011) 5e-102 Click
171318126..1318386 conserved hypothetical protein; XfasaDRAFT_1264 0.0 Click
181318386..1318709 conserved hypothetical protein; XfasaDRAFT_1265 0.0 Click
191318706..1319227 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; XfasaDRAFT_1266; phage(gi428782733) 4e-09 Click
201319203..1319745 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; XfasaDRAFT_1267; phage(gi428782734) 6e-11 Click
211319613..1320329 PHAGE_Mannhe_phiMHaA1: baseplate assembly protein V; XfasaDRAFT_1268; phage(gi109289954) 3e-26 Click
22complement(1320334..1320609) PHAGE_Azospi_Cd: Helix-turn-helix motif; XfasaDRAFT_1269; phage(gi168495160) 1e-07 Click
23complement(1320620..1320901) Plasmid maintenance system killer; XfasaDRAFT_1270 0.0 Click
241321099..1321437 PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; XfasaDRAFT_1271; phage(gi428782737) 1e-26 Click
251321437..1322330 PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; XfasaDRAFT_1272; phage(gi28198989) 6e-161 Click
261322311..1322880 PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_1409; phage(gi28198988) 2e-105 Click
271322594..1324480 PHAGE_Burkho_KS5: gp23; XfasaDRAFT_1273; phage(gi327198021) 1e-35 Click
281324544..1325722 PHAGE_Vibrio_vB_VpaM_MAR: tail sheath protein; XfasaDRAFT_1274; phage(gi428782746) 1e-113 Click
291325722..1326231 PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; XfasaDRAFT_1275; phage(gi428782747) 2e-35 Click
301326234..1326521 conserved hypothetical protein; XfasaDRAFT_1276 0.0 Click
311326648..1328861 PHAGE_Entero_2: P2 gpT-like tail protein; XfasaDRAFT_1277; phage(gi169936021) 1e-88 Click
321328858..1329340 PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_1278; phage(gi28198982) 2e-87 Click
331329337..1329555 PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_1417; phage(gi28198981) 8e-38 Click
341329546..1330628 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; XfasaDRAFT_1279; phage(gi428782753) 2e-48 Click
35complement(1331003..1332022) Tetraacyldisaccharide-1-P 4'-kinase; XfasaDRAFT_1280 0.0 Click
36complement(1332019..1333767) PHAGE_Bacill_SPBc2: ABC transporter; XfasaDRAFT_1281; phage(gi9630145) 6e-28 Click

Region 6, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1756444..1759533) PROPHAGE_Xylell_Temecula1: serine protease; XfasaDRAFT_0849; phage(gi77747673) 0.0 Click
21759957..1760256 PROPHAGE_Escher_Sakai: putative transposase; XfasaDRAFT_0900; phage(gi38704244) 1e-19 Click
3complement(1760338..1760919) putative DNA topoisomerase III; XfasaDRAFT_0850 0.0 Click
41761452..1761751 Plasmid maintenance system killer; XfasaDRAFT_0901 0.0 Click
51761727..1762875 PHAGE_Azospi_Cd: Helix-turn-helix motif; XfasaDRAFT_0851; phage(gi168495160) 3e-07 Click
61762909..1763388 conserved hypothetical protein; XfasaDRAFT_0852 0.0 Click
7complement(1763418..1764581) PHAGE_Pectob_ZF40: putative tail-fiber protein; XfasaDRAFT_0853; phage(gi422936707) 6e-29 Click
8complement(1764585..1765145) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p49; XfasaDRAFT_0854; phage(gi31544052) 2e-33 Click
9complement(1765142..1766287) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p48; XfasaDRAFT_0855; phage(gi31544051) 1e-96 Click
101766390..1766686 PHAGE_Burkho_2: gp7, putative addiction module killer protein; XfasaDRAFT_0856; phage(gi134288691) 4e-17 Click
111766689..1766982 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; XfasaDRAFT_0857; phage(gi134288715) 9e-13 Click
12complement(1767038..1767391) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p47; XfasaDRAFT_0858; phage(gi31544050) 2e-27 Click
13complement(1767388..1768029) PHAGE_Haemop_Aaphi23: putative baseplate protein; XfasaDRAFT_0859; phage(gi31544048) 5e-32 Click
14complement(1768026..1768856) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p45; XfasaDRAFT_0860; phage(gi31544047) 5e-78 Click
15complement(1768853..1769170) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p44; XfasaDRAFT_0861; phage(gi44829138) 2e-21 Click
16complement(1769170..1769940) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p43; XfasaDRAFT_0862; phage(gi31544045) 1e-39 Click
17complement(1770300..1770560) hypothetical protein; XfasaDRAFT_0902 0.0 Click
18complement(1770838..1772232) PHAGE_Haemop_Aaphi23: putative tail length tape measure protein; XfasaDRAFT_0863; phage(gi31544043) 3e-23 Click
19complement(1772737..1772812) tRNA 0.0 Click
20complement(1772923..1772999) tRNA 0.0 Click
21complement(1773039..1773117) tRNA 0.0 Click
22complement(1773180..1773256) tRNA 0.0 Click
231773433..1774194 Protein of unknown function DUF1112; XfasaDRAFT_0864 0.0 Click
24complement(1774782..1779710) PHAGE_Acanth_1: hypothetical protein ATCV1_Z492L; XfasaDRAFT_0865; phage(gi155371439) 5e-09 Click

Region 7, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12089926..2090333 PROPHAGE_Mesorh_MAFF303099: bacteriophage integrase; XfasaDRAFT_0757; phage(gi13470699) 3e-05 Click
2complement(2090446..2090601) conserved hypothetical protein; XfasaDRAFT_0758 0.0 Click
3complement(2090807..2091889) PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0747; phage(gi28198980) 0.0 Click
4complement(2091880..2092098) PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0759; phage(gi28198981) 8e-38 Click
5complement(2092095..2092422) PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0748; phage(gi28198982) 5e-59 Click
62092702..2093262 PHAGE_Xylell_Xfas53: gp16; XfasaDRAFT_0609; phage(gi273810435) 9e-13 Click
72093259..2093720 conserved hypothetical protein; XfasaDRAFT_0673 0.0 Click
82093717..2094124 PHAGE_Xylell_Xfas53: gp14; XfasaDRAFT_0610; phage(gi273810433) 7e-56 Click
92094121..2094312 conserved hypothetical protein; XfasaDRAFT_0611 0.0 Click
102094336..2094527 PHAGE_Xylell_Xfas53: gp13; XfasaDRAFT_0674; phage(gi273810432) 5e-19 Click
112094559..2094753 PHAGE_Xylell_Xfas53: gp12; XfasaDRAFT_0675; phage(gi273810431) 2e-29 Click
122094753..2095241 PHAGE_Xylell_Xfas53: gp11; XfasaDRAFT_0612; phage(gi273810430) 4e-87 Click
132095238..2096515 PHAGE_Xylell_Xfas53: gp10; XfasaDRAFT_0613; phage(gi273810429) 0.0 Click
142096515..2097081 PHAGE_Xylell_Xfas53: gp09; XfasaDRAFT_0614; phage(gi273810428) 1e-104 Click
152097090..2098316 PHAGE_Xylell_Xfas53: Bro-N family protein; XfasaDRAFT_0615; phage(gi273810427) 5e-171 Click
162098318..2100498 PHAGE_Xylell_Xfas53: DNA polymerase A; XfasaDRAFT_0616; phage(gi273810426) 0.0 Click
172100495..2100773 PHAGE_Xylell_Xfas53: putative nuclease; XfasaDRAFT_0617; phage(gi273810425) 5e-46 Click
18complement(2100775..2101308) phage-related protein; XfasaDRAFT_0618 0.0 Click
192101393..2102811 PHAGE_Xylell_Xfas53: helicase; XfasaDRAFT_0619; phage(gi273810423) 0.0 Click
202102808..2102972 PHAGE_Xylell_Xfas53: gp03; XfasaDRAFT_0676; phage(gi273810422) 3e-24 Click
212102965..2103213 PHAGE_Xylell_Xfas53: gp02; XfasaDRAFT_0677; phage(gi273810421) 3e-38 Click
222103213..2104232 PHAGE_Xylell_Xfas53: integrase; XfasaDRAFT_0620; phage(gi273810420) 5e-175 Click
23complement(2104313..2106247) PHAGE_Parame_FR483: hypothetical protein FR483_N733R; XfasaDRAFT_0621; phage(gi155370831) 2e-30 Click

Region 8, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12237678..2237689 attL    CCACGATGACGA 0.0 Click
2complement(2245819..2246739) PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0363; phage(gi28198980) 2e-173 Click
32246912..2247202 DNA polymerase, beta-like region; XfasaDRAFT_0375 0.0 Click
42247199..2247567 Protein of unknown function DUF86; XfasaDRAFT_0376 0.0 Click
52247813..2248163 conserved hypothetical protein; XfasaDRAFT_0377 0.0 Click
62248449..2248904 conserved hypothetical protein; XfasaDRAFT_0378 0.0 Click
72248901..2249452 PHAGE_Xylell_Xfas53: gp16; XfasaDRAFT_0379; phage(gi273810435) 4e-10 Click
82249449..2249919 Protein of unknown function DUF1566; XfasaDRAFT_0443 0.0 Click
92249916..2250323 PHAGE_Xylell_Xfas53: gp14; XfasaDRAFT_0380; phage(gi273810433) 7e-56 Click
102250320..2250511 conserved hypothetical protein; XfasaDRAFT_0381 0.0 Click
112250555..2251082 hypothetical protein; XfasaDRAFT_0382 0.0 Click
122250889..2251392 PHAGE_Xylell_Xfas53: gp13; XfasaDRAFT_0444; phage(gi273810432) 2e-17 Click
132251413..2251775 PHAGE_Vibrio_VvAW1: hypothetical protein; XfasaDRAFT_0383; phage(gi460042912) 2e-21 Click
142251797..2252618 PHAGE_Xantho_CP2: hypothetical protein; XfasaDRAFT_0384; phage(gi448245210) 5e-57 Click
152252634..2253554 PHAGE_Lactoc_phiLC3: hypothetical protein phiLC3p10; XfasaDRAFT_0385; phage(gi45597399) 5e-05 Click
162253551..2255194 PHAGE_Erwini_vB_EamM_Y2: tail fiber; XfasaDRAFT_0386; phage(gi422934766) 2e-05 Click
172255359..2256201 PHAGE_Ralsto_phiRSA1: hypothetical protein RPRSA1_gp39; XfasaDRAFT_0387; phage(gi145708113) 3e-21 Click
182256268..2256714 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; XfasaDRAFT_0388; phage(gi56692915) 3e-34 Click
192256690..2256701 attR    CCACGATGACGA 0.0 Click
202256951..2258144 PHAGE_Pseudo_vB_PaeS_PMG1: integrase; XfasaDRAFT_0389; phage(gi374531680) 1e-06 Click
21complement(2258095..2258169) tRNA 0.0 Click
22complement(2258274..2260283) PHAGE_Acidia_9: putative helicase; XfasaDRAFT_0390; phage(gi171473669) 1e-07 Click

Region 9, total : 133 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12526090..2527652 PHAGE_Salmon_1: putative bacteriophage portal protein; XfasaDRAFT_0150; phage(gi169257187) 7e-100 Click
22527649..2529964 PHAGE_Stenot_S1: putative major head protein; XfasaDRAFT_0151; phage(gi213163906) 1e-83 Click
32530037..2530396 PHAGE_Stenot_S1: putative recombinase; XfasaDRAFT_0152; phage(gi213163907) 2e-09 Click
42530469..2530693 PHAGE_Xylell_Xfas53: holin; XfasaDRAFT_0166; phage(gi273810444) 1e-09 Click
52530686..2531267 PHAGE_Xylell_Xfas53: SAR endolysin; XfasaDRAFT_0153; phage(gi273810445) 1e-66 Click
62531407..2532192 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; XfasaDRAFT_0154; phage(gi148912828) 2e-27 Click
72532189..2532509 conserved hypothetical protein; XfasaDRAFT_0155 0.0 Click
82532506..2532979 conserved hypothetical protein; XfasaDRAFT_0156 0.0 Click
92532976..2533725 PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; XfasaDRAFT_0157; phage(gi148912775) 4e-17 Click
102533722..2534168 PHAGE_Pseudo_MP38: hypothetical protein gpG; XfasaDRAFT_0158; phage(gi215479975) 8e-07 Click
112534165..2534332 conserved hypothetical protein; XfasaDRAFT_0159 0.0 Click
122534333..2536846 PHAGE_Loktan_pCB2051_A: tail length tape measure protein; XfasaDRAFT_0160; phage(gi472341411) 2e-20 Click
132536839..2538026 PHAGE_Pseudo_B3: hypothetical protein B3ORF52; XfasaDRAFT_0161; phage(gi56692621) 8e-44 Click
142538016..2539458 PHAGE_Burkho_AH2: tail assembly protein; XfasaDRAFT_0162; phage(gi399529086) 5e-11 Click
152539449..2539877 PHAGE_Pseudo_MP1412: tail assembly structural protein; XfasaDRAFT_0163; phage(gi399529036) 7e-07 Click
162539874..2540110 PHAGE_Pseudo_JBD24: hypothetical protein; XfasaDRAFT_0164; phage(gi448245099) 5e-13 Click
17complement(2540190..2540738) hypothetical protein; XfasaDRAFT_0168 0.0 Click
18complement(2541297..2541584) hypothetical protein; XfasaDRAFT_0167 0.0 Click
192541704..2543371 hemagglutinin-like protein; XfasaDRAFT_0042 0.0 Click
202542869..2542881 attL    TGACGAAAAATAA 0.0 Click
212543384..2544229 Protein of unknown function DUF769; XfasaDRAFT_0043 0.0 Click
222544226..2545410 hemagglutinin-like secreted protein; XfasaDRAFT_0044 0.0 Click
232545423..2546268 Protein of unknown function DUF769; XfasaDRAFT_0045 0.0 Click
242546265..2547143 conserved hypothetical protein; XfasaDRAFT_0046 0.0 Click
252547156..2547998 Protein of unknown function DUF769; XfasaDRAFT_0047 0.0 Click
262547995..2548873 conserved hypothetical protein; XfasaDRAFT_0048 0.0 Click
272548886..2549923 hypothetical protein; XfasaDRAFT_0049 0.0 Click
282549928..2550311 Protein of unknown function DUF596; XfasaDRAFT_0050 0.0 Click
292550591..2550842 conserved hypothetical protein; XfasaDRAFT_0051 0.0 Click
302550823..2551245 Protein of unknown function DUF596; XfasaDRAFT_0057 0.0 Click
312551513..2551749 conserved hypothetical protein; XfasaDRAFT_0058 0.0 Click
322551964..2552134 Protein of unknown function DUF596; XfasaDRAFT_0052 0.0 Click
33complement(2552455..2552997) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p43; XfasaDRAFT_0053; phage(gi31544045) 1e-22 Click
342553122..2553376 plasmid stabilization protein; XfasaDRAFT_0054 0.0 Click
352553377..2553805 PilT protein, N-terminal; XfasaDRAFT_0055 0.0 Click
36complement(2553895..2554673) PHAGE_Strept_SMP: tail tape measure protein; XfasaDRAFT_0056; phage(gi119953746) 1e-05 Click
372554674..2554985 conserved hypothetical protein; XfasaDRAFT_0101 0.0 Click
38complement(2555019..2555693) PHAGE_Salmon_ST160: C2; XfasaDRAFT_0102; phage(gi318065925) 1e-24 Click
392555769..2555981 conserved hypothetical protein; XfasaDRAFT_0113 0.0 Click
402556591..2556779 PHAGE_Burkho_KL3: gp11; XfasaDRAFT_0103; phage(gi327198056) 4e-06 Click
412556776..2557024 conserved hypothetical protein; XfasaDRAFT_0114 0.0 Click
422557021..2557914 PHAGE_Xylell_Xfas53: repeat-encoded protein; XfasaDRAFT_0104; phage(gi273810440) 4e-27 Click
432558050..2560581 PHAGE_Xylell_Xfas53: P4 family phage/plasmid primase; XfasaDRAFT_0105; phage(gi273810442) 0.0 Click
442561118..2561735 PHAGE_Burkho_KS10: hypothetical protein KS10_gp27; XfasaDRAFT_0106; phage(gi198449289) 3e-05 Click
452561702..2562196 PHAGE_Acinet_AP22: putative endolysin/autolysin; XfasaDRAFT_0107; phage(gi388570824) 3e-28 Click
462562189..2562518 PHAGE_Burkho_BcepNY3: holin; XfasaDRAFT_0108; phage(gi149882929) 3e-08 Click
472562508..2562969 conserved hypothetical protein; XfasaDRAFT_0109 0.0 Click
482562971..2563195 conserved hypothetical protein; XfasaDRAFT_0115 0.0 Click
492563326..2563901 PHAGE_Entero_mEp237: terminase small subunit nu1; XfasaDRAFT_0110; phage(gi435439266) 1e-10 Click
502563894..2565846 PHAGE_Synech_S_CBS1: large terminase subunit; XfasaDRAFT_0111; phage(gi356870795) 4e-62 Click
512565850..2566401 PHAGE_Vibrio_VP882: putative phage-related protein; XfasaDRAFT_0112; phage(gi126010851) 4e-28 Click
52complement(2567360..2567650) DNA polymerase, beta-like region; XfasaDRAFT_0066 0.0 Click
53complement(2567673..2568212) PHAGE_Burkho_BcepMu: gp19; XfasaDRAFT_0067; phage(gi48696929) 4e-16 Click
54complement(2568887..2569768) hypothetical protein; XfasaDRAFT_0080 0.0 Click
552570094..2570459 hypothetical protein; XfasaDRAFT_0079 0.0 Click
562570720..2571514 PHAGE_Xylell_Xfas53: Bro-N family protein; XfasaDRAFT_0068; phage(gi273810441) 2e-24 Click
572571544..2572656 PHAGE_Xylell_Xfas53: Bro-N family protein; XfasaDRAFT_0069; phage(gi273810427) 5e-109 Click
582572635..2572913 hypothetical protein; XfasaDRAFT_0081 0.0 Click
592572915..2573763 PHAGE_Pseudo_phi297: putative DNA replication protein O; XfasaDRAFT_0070; phage(gi374531278) 2e-07 Click
602573760..2575220 PHAGE_Entero_P1: Ban; XfasaDRAFT_0071; phage(gi46401697) 1e-70 Click
612575226..2575636 PHAGE_Sulfit_pCB2047_A: hypothetical protein; XfasaDRAFT_0072; phage(gi472341907) 6e-13 Click
622575765..2576463 PHAGE_Xylell_Xfas53: gp24; XfasaDRAFT_0073; phage(gi273810443) 5e-106 Click
632576629..2577129 PHAGE_Acinet_AP22: putative endolysin/autolysin; XfasaDRAFT_0074; phage(gi388570824) 6e-28 Click
642577122..2577451 PHAGE_Burkho_BcepNY3: holin; XfasaDRAFT_0075; phage(gi149882929) 3e-08 Click
652577441..2577902 conserved hypothetical protein; XfasaDRAFT_0076 0.0 Click
662577904..2578116 conserved hypothetical protein; XfasaDRAFT_0082 0.0 Click
672578208..2578606 conserved hypothetical protein; XfasaDRAFT_0077 0.0 Click
682578557..2579348 PHAGE_Vibrio_CP_T1: putative TerL large-subunit terminase; XfasaDRAFT_0078; phage(gi418489210) 1e-47 Click
692579350..2579811 conserved hypothetical protein; XfasaDRAFT_0030 0.0 Click
702579841..2580953 PHAGE_Xylell_Xfas53: Bro-N family protein; XfasaDRAFT_0031; phage(gi273810427) 5e-109 Click
712581074..2581364 hypothetical protein; XfasaDRAFT_0040 0.0 Click
722581420..2582496 PHAGE_Mycoba_Brujita: gp63; XfasaDRAFT_0032; phage(gi206599607) 2e-19 Click
732582402..2583166 conserved hypothetical protein; XfasaDRAFT_0033 0.0 Click
742583214..2583624 PHAGE_Sulfit_pCB2047_A: hypothetical protein; XfasaDRAFT_0034; phage(gi472341907) 1e-12 Click
752583753..2584451 PHAGE_Xylell_Xfas53: gp24; XfasaDRAFT_0035; phage(gi273810443) 5e-106 Click
762584618..2585118 PHAGE_Pseudo_PA11: hypothetical protein ORF033; XfasaDRAFT_0036; phage(gi149408192) 6e-28 Click
772585111..2585440 conserved hypothetical protein; XfasaDRAFT_0037 0.0 Click
782585430..2585891 conserved hypothetical protein; XfasaDRAFT_0038 0.0 Click
792585893..2586117 conserved hypothetical protein; XfasaDRAFT_0041 0.0 Click
802586248..2586823 PHAGE_Entero_mEp237: terminase small subunit nu1; XfasaDRAFT_0039; phage(gi435439266) 1e-10 Click
812587208..2588291 PHAGE_Synech_S_CBS3: major capsid protein; XfasaDRAFT_0089; phage(gi331028011) 2e-79 Click
822588309..2588569 conserved hypothetical protein; XfasaDRAFT_0090 0.0 Click
832588569..2588892 conserved hypothetical protein; XfasaDRAFT_0091 0.0 Click
842588889..2589410 PHAGE_Vibrio_VP882: putative phage-related protein; XfasaDRAFT_0092; phage(gi126010915) 3e-16 Click
852589386..2589928 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; XfasaDRAFT_0099; phage(gi428782734) 8e-11 Click
862589796..2590512 PHAGE_Mannhe_phiMHaA1: baseplate assembly protein V; XfasaDRAFT_0093; phage(gi109289954) 2e-26 Click
87complement(2590549..2590830) Plasmid stabilization system; XfasaDRAFT_0094 0.0 Click
88complement(2590817..2591080) RelB antitoxin; XfasaDRAFT_0095 0.0 Click
892591230..2591568 PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; XfasaDRAFT_0096; phage(gi28198990) 2e-54 Click
902591568..2592461 PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; XfasaDRAFT_0097; phage(gi28198989) 6e-161 Click
912592454..2593011 PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0098; phage(gi28198988) 2e-105 Click
922593019..2593282 PHAGE_Burkho_KS5: gp23; XfasaDRAFT_0100; phage(gi327198021) 1e-14 Click
93complement(2593315..2595081) PHAGE_Entero_2: P2 gpT-like tail protein; XfasaDRAFT_0083; phage(gi169936021) 1e-78 Click
94complement(2595208..2595495) conserved hypothetical protein; XfasaDRAFT_0084 0.0 Click
95complement(2595498..2596007) PHAGE_Vibrio_VHML: major tail tube protein; XfasaDRAFT_0085; phage(gi27311208) 2e-35 Click
96complement(2596007..2597185) PROPHAGE_Xylell_Temecula1: contractile tail sheath protein; XfasaDRAFT_0086; phage(gi28198986) 0.0 Click
97complement(2597249..2599135) PHAGE_Burkho_KS5: gp23; XfasaDRAFT_0087; phage(gi327198021) 1e-35 Click
98complement(2598849..2599358) PROPHAGE_Xylell_Temecula1: phage-related tail protein; XfasaDRAFT_0088; phage(gi28198988) 2e-95 Click
992599374..2599742 PHAGE_Stenot_phiSMA9: putative zonula occludens toxin; XfasaDRAFT_0011; phage(gi70727682) 2e-17 Click
100complement(2599904..2600173) conserved hypothetical protein; XfasaDRAFT_0015 0.0 Click
101complement(2600233..2600583) PHAGE_Stenot_phiSMA9: hypothetical protein phiSMA9p3; XfasaDRAFT_0012; phage(gi70727681) 5e-11 Click
1022600829..2600841 attR    TGACGAAAAATAA 0.0 Click
103complement(2601060..2601133) tRNA 0.0 Click
104complement(2601133..2601963) PHAGE_Aggreg_S1249: putative integrase; XfasaDRAFT_0013; phage(gi273809608) 3e-64 Click
1052602226..2602474 conserved hypothetical protein; XfasaDRAFT_0016 0.0 Click
106complement(2602636..2603351) PHAGE_Stenot_phiSMA9: putative zonula occludens toxin; XfasaDRAFT_0014; phage(gi70727682) 2e-26 Click
1072603419..2603532 phage-related protein; XfasaDRAFT_0065 0.0 Click
1082603542..2604024 PHAGE_Iodoba_phiPLPE: hypothetical protein phiPLPE_28; XfasaDRAFT_0059; phage(gi197085642) 1e-05 Click
1092604040..2605017 PHAGE_Vibrio_vB_VchM_138: putative major capsid protein; XfasaDRAFT_0060; phage(gi422936575) 1e-35 Click
1102605082..2605381 conserved hypothetical protein; XfasaDRAFT_0061 0.0 Click
1112605384..2605755 PHAGE_Aggreg_S1249: hypothetical protein; XfasaDRAFT_0062; phage(gi273809562) 1e-16 Click
1122605752..2606231 PHAGE_Psychr_pOW20_A: hypothetical protein; XfasaDRAFT_0063; phage(gi472339833) 6e-17 Click
1132606337..2606585 PHAGE_Aggreg_S1249: hypothetical protein; XfasaDRAFT_0064; phage(gi273809560) 9e-16 Click
1142606752..2607294 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; XfasaDRAFT_0029; phage(gi428782734) 8e-11 Click
1152607162..2607878 PHAGE_Mannhe_phiMHaA1: baseplate assembly protein V; XfasaDRAFT_0023; phage(gi109289954) 2e-26 Click
116complement(2607883..2608182) PHAGE_Azospi_Cd: Helix-turn-helix motif; XfasaDRAFT_0024; phage(gi168495160) 9e-10 Click
117complement(2608194..2608475) helix-turn-helix motif; XfasaDRAFT_0025 0.0 Click
118complement(2608477..2608791) PHAGE_Entero_N15: gp49; XfasaDRAFT_0026; phage(gi9630516) 4e-09 Click
1192608925..2609263 PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; XfasaDRAFT_0027; phage(gi28198990) 2e-54 Click
1202609263..2609928 PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; XfasaDRAFT_0028; phage(gi28198989) 1e-118 Click
1212610170..2610358 conserved hypothetical protein; XfasaDRAFT_0004 0.0 Click
1222610355..2610966 Filamentation induced by cAMP protein Fic; XfasaDRAFT_0001 0.0 Click
123complement(2611017..2611796) PHAGE_Cronob_ENT47670: putative transcriptional regulator; XfasaDRAFT_0002; phage(gi431810510) 9e-16 Click
124complement(2611729..2612694) hypothetical protein; XfasaDRAFT_0005 0.0 Click
1252612633..2613046 PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; XfasaDRAFT_0003; phage(gi428782734) 3e-08 Click
126complement(2613135..2613425) hypothetical protein; XfasaDRAFT_0006 0.0 Click
127complement(2613750..2614004) hypothetical protein; XfasaDRAFT_0010 0.0 Click
128complement(2614005..2614556) PHAGE_Human__4: EBNA-1; XfasaDRAFT_0007; phage(gi82503233) 1e-10 Click
129complement(2614599..2615012) PHAGE_Human__4: EBNA-1; XfasaDRAFT_0009; phage(gi82503233) 6e-07 Click
130complement(2615019..2615387) hypothetical protein; XfasaDRAFT_0008 0.0 Click
1312615727..2617022 PHAGE_Vibrio_vB_VchM_138: putative portal protein; XfasaDRAFT_0021; phage(gi422936563) 7e-65 Click
1322616934..2617779 PHAGE_Psychr_pOW20_A: phage head morphogenesis protein; XfasaDRAFT_0022; phage(gi472339824) 5e-39 Click
1332618031..2618828 PHAGE_Strept_SV1: putative tail tape measure protein; XfasaDRAFT_0017; phage(gi410491736) 2e-06 Click
134complement(2618839..2619105) PHAGE_Mycoba_Fruitloop: gp41; XfasaDRAFT_0018; phage(gi206599921) 1e-05 Click
135complement(2619089..2619379) Helix-turn-helix protein, CopG; XfasaDRAFT_0019 0.0 Click
1362619427..2620197 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p43; XfasaDRAFT_0020; phage(gi31544045) 3e-39 Click