Shigella flexneri 2a str. 301, complete genome. [asmbl_id: NC_000000].4607202, GC%: 50.89%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1235830..236240 PROPHAGE_Escher_CFT073: transposase insC; SF0209; phage(gi26249447) 4e-52 Click
2236198..237103 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF0210; phage(gi24111655) 4e-179 Click
3complement(237160..237447) hypothetical protein; SF0211 0.0 Click
4complement(237461..237982) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF0212; phage(gi41057343) 5e-104 Click
5complement(237951..238301) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF0213; phage(gi41057343) 7e-58 Click
6complement(238328..238666) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF0214; phage(gi24373865) 3e-09 Click
7238841..239743 PHAGE_Entero_IME10_NC_019501: terminase large subunit; SF0215; phage(gi422934280) 0.0 Click
8239744..241909 PHAGE_Entero_IME10_NC_019501: portal protein; SF0216; phage(gi422934281) 0.0 Click
9241923..242834 PHAGE_Entero_IME10_NC_019501: scaffolding protein; SF0217; phage(gi422934282) 5e-168 Click
10242834..244129 PHAGE_Entero_IME10_NC_019501: coat protein; SF0218; phage(gi422934283) 0.0 Click
11244174..244404 PHAGE_Salmon_SPN9CC_NC_017985: hypothetical protein; SF0219; phage(gi389060541) 4e-05 Click
12244382..244882 PHAGE_Entero_IME10_NC_019501: DNA stabilization protein; SF0220; phage(gi422934284) 1e-93 Click
13244882..246300 PHAGE_Entero_IME10_NC_019501: DNA stabilization protein; SF0221; phage(gi422934285) 0.0 Click
14246300..247148 PHAGE_Entero_P22_NC_002371: head completion protein; SF0222; phage(gi51236728) 1e-38 Click
15247148..247603 PHAGE_Entero_IME10_NC_019501: head assembly protein; SF0223; phage(gi422934287) 8e-87 Click
16247606..248298 PHAGE_Entero_IME10_NC_019501: DNA transfer protein; SF0224; phage(gi422934288) 4e-127 Click
17248308..249639 PHAGE_Entero_IME10_NC_019501: gp20; SF0225; phage(gi422934289) 0.0 Click
18249640..251370 PHAGE_Entero_P22_NC_002371: injection protein; SF0226; phage(gi51236731) 5e-58 Click
19251496..251822 PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF0227; phage(gi157166066) 2e-56 Click
20252037..252705 PROPHAGE_Escher_CFT073: transposase IS629; SF0228; phage(gi26250986) 1e-122 Click

Region 2, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1304245..304256 attL    CGCAACCTATTT 0.0 Click
2308132..308527 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF0291; phage(gi557307573) 3e-68 Click
3308718..309821 gamma-glutamate kinase; SF0292 0.0 Click
4309833..311086 gamma-glutamylphosphate reductase; SF0293 0.0 Click
5311201..311276 tRNA 0.0 Click
6complement(311291..311755) PHAGE_Shigel_SfII_NC_021857: integrase; SF0294; phage(gi526244664) 5e-84 Click
7complement(311782..312600) PROPHAGE_Escher_CFT073: transposase insF; SF0295; phage(gi26249410) 2e-157 Click
8complement(312636..312938) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0296; phage(gi526244690) 4e-09 Click
9complement(312995..313720) PHAGE_Shigel_SfII_NC_021857: integrase; SF0297; phage(gi526244664) 5e-137 Click
10complement(313947..314252) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0298; phage(gi526244666) 1e-53 Click
11complement(314252..314629) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0299; phage(gi526244667) 7e-55 Click
12complement(314595..315263) PROPHAGE_Escher_CFT073: transposase IS629; SF0300; phage(gi26250986) 9e-122 Click
13315442..315478 attL    CCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCAT 0.0 Click
14complement(315478..315804) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF0301; phage(gi157166066) 1e-55 Click
15316047..316349 PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0302; phage(gi526244690) 5e-09 Click
16316385..317203 PROPHAGE_Escher_CFT073: transposase insF; SF0303; phage(gi26249410) 1e-157 Click
17317312..317605 PHAGE_Entero_c_1_NC_019706: integrase; SF0304; phage(gi428781759) 6e-52 Click
18317742..317753 attL    AAAGCCTTGCAA 0.0 Click
19317867..318229 PHAGE_Shigel_SfII_NC_021857: putative flipase; SF0305; phage(gi526244663) 7e-63 Click
20318226..319155 PHAGE_Shigel_SfII_NC_021857: bactoprenol glucosyltransferase; SF0306; phage(gi526244662) 3e-177 Click
21319152..320612 PHAGE_Shigel_SfII_NC_021857: serotype-specific glucosyltransferase; SF0307; phage(gi526244661) 0.0 Click
22complement(321002..322192) PHAGE_Shigel_SfII_NC_021857: transposase; SF0308; phage(gi526244660) 0.0 Click
23322643..323692 PHAGE_Shigel_SfII_NC_021857: acyltransferase; SF0309; phage(gi526244659) 0.0 Click
24complement(324465..324899) PHAGE_Shigel_SfII_NC_021857: tail fiber assembly protein; SF0310; phage(gi526244658) 9e-81 Click
25complement(324871..325521) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0311; phage(gi526244657) 3e-120 Click
26complement(325574..326392) PROPHAGE_Escher_CFT073: transposase insF; SF0312; phage(gi26249410) 2e-158 Click
27complement(326428..326730) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0313; phage(gi526244690) 1e-08 Click
28326916..328079 PHAGE_Shigel_SfII_NC_021857: integrase; SF0314; phage(gi526244664) 0.0 Click
29328305..328316 attR    AAAGCCTTGCAA 0.0 Click
30328428..329600 PHAGE_Escher_TL_2011b_NC_019445: hypothetical protein; SF0315; phage(gi418487678) 7e-13 Click
31complement(329654..330277) PHAGE_Synech_Syn5_NC_009531: tail fiber; SF0316; phage(gi148724489) 2e-05 Click
32complement(330404..331222) PROPHAGE_Escher_CFT073: transposase insF; SF0317; phage(gi26249410) 1e-157 Click
33complement(331258..331620) PHAGE_Shigel_SfII_NC_021857: hypothetical protein; SF0318; phage(gi526244690) 1e-08 Click
34complement(331586..332254) PROPHAGE_Escher_CFT073: transposase IS629; SF0319; phage(gi26250986) 3e-124 Click
35332433..332469 attR    CCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCAT 0.0 Click
36complement(332469..332795) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF0320; phage(gi157166066) 2e-53 Click
37332946..334061 PHAGE_Bacill_G_NC_023719: gp350; SF0321; phage(gi593777806) 5e-16 Click
38346620..346631 attR    CGCAACCTATTT 0.0 Click

Region 3, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(696659..697168) PHAGE_Pseudo_MP22_NC_009818: transposase A; SF0661; phage(gi157834977) 3e-06 Click
2697731..699185 PHAGE_Entero_Mu_NC_000929: transposase; SF0662; phage(gi9633496) 0.0 Click
3699247..699549 PROPHAGE_Xantho_33913: ISxac3 transposase; SF0663; phage(gi21231087) 1e-09 Click
4699585..700403 PROPHAGE_Escher_CFT073: transposase insF; SF0664; phage(gi26249410) 2e-156 Click
5700415..700690 hypothetical protein; SF0665 0.0 Click
6complement(700687..701628) PHAGE_Vibrio_CP_T1_NC_019457: putative major capsid protein; SF0666; phage(gi418489228) 1e-15 Click
7complement(701773..702129) putative bacteriophage protein; SF0667 0.0 Click
8complement(702133..703353) PHAGE_Pectob_ZF40_NC_019522: putative head protein; SF0668; phage(gi422936684) 4e-18 Click
9complement(703357..703815) PROPHAGE_Deinoc_R1: head morphogenesis protein, putative; SF0669; phage(gi15807765) 3e-13 Click
10complement(703991..705457) PHAGE_Vibrio_CP_T1_NC_019457: putative portal protein; SF0670; phage(gi418489212) 2e-40 Click
11complement(705678..706217) PHAGE_Psychr_pOW20_A_NC_020841: phage terminase large subunit; SF0671; phage(gi472339822) 7e-44 Click
12complement(706202..707107) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF0672; phage(gi24111655) 8e-179 Click
13complement(707065..707475) PROPHAGE_Escher_CFT073: transposase insC; SF0673; phage(gi26249447) 3e-52 Click
14complement(707506..708129) PHAGE_Psychr_pOW20_A_NC_020841: phage terminase large subunit; SF0674; phage(gi472339822) 2e-80 Click
15complement(708140..708904) PHAGE_Escher_P13374_NC_018846: phage terminase small subunit; SF0675; phage(gi410491651) 7e-17 Click
16709099..709611 conserved hypothetical protein; SF0676 0.0 Click
17709982..710320 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF0677; phage(gi24373865) 3e-09 Click
18710347..711186 PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF0678; phage(gi41057343) 1e-169 Click
19711215..711637 putative bacteriophage protein; SF0679 0.0 Click
20711827..711903 tRNA 0.0 Click
21711905..711981 tRNA 0.0 Click
22711984..712058 tRNA 0.0 Click
23712062..712136 tRNA 0.0 Click
24complement(712950..713768) PROPHAGE_Escher_CFT073: transposase insF; SF0680; phage(gi26249410) 2e-157 Click
25complement(713804..714106) PROPHAGE_Xantho_33913: ISxac3 transposase; SF0681; phage(gi21231087) 1e-09 Click
26714382..716241 PHAGE_Entero_Min27_NC_010237: putative replication protein P; SF0682; phage(gi170783639) 0.0 Click
27complement(716216..717055) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF0683; phage(gi41057343) 1e-169 Click
28complement(717082..717420) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF0685; phage(gi24373865) 3e-09 Click
29717477..718355 PHAGE_Entero_phiP27_NC_003356: putative replication protein DnaC; SF0684; phage(gi18249882) 3e-140 Click
30718352..719743 PHAGE_Entero_phiP27_NC_003356: putative helicase; SF0686; phage(gi18249883) 0.0 Click
31719740..719997 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p20; SF0687; phage(gi18249884) 2e-36 Click
32720285..720665 PHAGE_Entero_YYZ_2008_NC_011356: antitermination protein Q; SF0688; phage(gi209427762) 2e-62 Click
33720865..720941 tRNA 0.0 Click
34720943..721019 tRNA 0.0 Click
35721022..721097 tRNA 0.0 Click
36721101..721175 tRNA 0.0 Click
37721468..721683 PHAGE_Escher_P13374_NC_018846: lysis protein, holin; SF0689; phage(gi410491645) 5e-27 Click
38721687..722316 PHAGE_Stx2_converting_86_NC_008464: hypothetical protein Stx2-86_gp05; SF0690; phage(gi116221997) 3e-32 Click
39722646..722915 PHAGE_Entero_mEp460_NC_019716: endolysin; SF0691; phage(gi428782372) 3e-49 Click
40722912..723316 PHAGE_Entero_HK620_NC_002730: endopeptidase; SF0692; phage(gi13559860) 3e-68 Click
41723378..723680 PROPHAGE_Xantho_33913: ISxac3 transposase; SF0693; phage(gi21231087) 1e-09 Click
42complement(723731..724165) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfB protein of IS629; SF0694; phage(gi157166067) 7e-70 Click
43complement(724247..724600) PROPHAGE_Escher_CFT073: transposase; SF0695; phage(gi26249430) 9e-37 Click
44complement(724600..724926) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF0696; phage(gi157166066) 4e-54 Click
45725011..725829 PROPHAGE_Escher_CFT073: transposase insF; SF0697; phage(gi26249410) 2e-158 Click
46725857..726180 PHAGE_Entero_N15_NC_001901: gp1; terminase; phage small subunit; SF0698(gi9630465) 1e-18 Click
47726152..726757 PHAGE_Gifsy_1_NC_010392: DNA packaging protein; large terminase subunit; Lambda gpA homolog; terminase; phage large subunit; SF0699(gi169257235) 1e-85 Click
48726869..728062 PHAGE_Gifsy_1_NC_010392: DNA packaging protein; large terminase subunit; Lambda gpA homolog; terminase; phage large subunit; SF0700(gi169257235) 0.0 Click
49728263..729318 PHAGE_Gifsy_1_NC_010392: bacteriophage portal protein; Lambda gpB homolog; SF0701; phage(gi169257233) 6e-157 Click
50729233..729856 PHAGE_Gifsy_1_NC_010392: bacteriophage portal protein; Lambda gpB homolog; SF0702; phage(gi169257233) 5e-94 Click
51729846..731351 PHAGE_Gifsy_1_NC_010392: bacteriophage prohead protease; Lambda gpC homolog; SF0703; phage(gi169257232) 1e-171 Click
52731388..731735 PHAGE_Gifsy_1_NC_010392: bacteriophage head decoration protein; Lambda gpD homolog; SF0704; phage(gi169257231) 5e-42 Click
53731793..732821 PHAGE_Gifsy_1_NC_010392: bacteriophage major capsid protein; Lambda gpE homolog; SF0705; phage(gi169257230) 1e-172 Click
54732873..733259 PHAGE_Gifsy_1_NC_010392: bacteriophage accessory DNA packaging protein; Lambda FI homolog; SF0706; phage(gi169257229) 4e-13 Click
55733271..733648 PHAGE_Gifsy_1_NC_010392: bacteriophage minor capsid protein; forms tail attachment site on head; Lambda FII homolog; SF0707; phage(gi169257228) 2e-27 Click
56733635..734219 PHAGE_Gifsy_1_NC_010392: bacteriophage head-tail assembly protein; Lambda gpZ homolog; SF0708; phage(gi169257227) 8e-78 Click
57734216..734617 PHAGE_Gifsy_1_NC_010392: bacteriophage tail shaft stabilization protein; Lambda gpU homolog; SF0709; phage(gi169257225) 1e-50 Click
58734622..735368 PHAGE_Gifsy_1_NC_010392: bacteriophage major tail subunit; Lambda gpV homolog; SF0710; phage(gi169257224) 5e-106 Click
59735409..735813 PHAGE_Gifsy_1_NC_010392: bacteriophage tail assembly chaperone; Lambda gpG homolog; SF0711; phage(gi169257223) 3e-34 Click
60735822..736151 PHAGE_Gifsy_1_NC_010392: part of bacteriophage tail assembly chaperone gpG by translational frameshifting; Lambda gpT homolog; SF0712; phage(gi169257222) 2e-33 Click
61736123..739164 PHAGE_Gifsy_1_NC_010392: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; SF0713; phage(gi169257221) 0.0 Click
62739164..739493 PHAGE_Gifsy_1_NC_010392: bacteriophage tail tip assembly protein; Lambda gpM homolog; SF0714; phage(gi169257220) 2e-45 Click
63739493..740191 PHAGE_Entero_HK630_NC_019723: minor tail protein L; SF0715; phage(gi428782805) 3e-122 Click
64740196..740939 PHAGE_Entero_mEp460_NC_019716: tail fiber component; SF0716; phage(gi428782332) 7e-145 Click
65740903..741478 PHAGE_Entero_cdtI_NC_009514: putative tail component; SF0717; phage(gi148609399) 2e-85 Click
66741539..745018 PHAGE_Entero_cdtI_NC_009514: putative tail tip assembly protein; SF0718; phage(gi148609400) 0.0 Click
67745086..745685 PHAGE_Entero_BP_4795_NC_004813: outer membrane protein Lom precursor; SF0719; phage(gi157166058) 3e-106 Click
68745707..746810 PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF0720; phage(gi18249920) 3e-65 Click
69747111..747734 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF0721; phage(gi18249921) 2e-78 Click
70complement(747914..749677) PHAGE_Gifsy_1_NC_010392: leucine-rich repeat protein; SF0722; phage(gi169257209) 4e-10 Click
71complement(750260..750736) conserved hypothetical protein; SF0723 0.0 Click
72complement(750795..752195) PHAGE_Mycoba_Myrna_NC_011273: gp183; SF0725; phage(gi203454746) 6e-06 Click

Region 4, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1898668..899342 PHAGE_Stx2_converting_1717_NC_011357: truncated transposase; SF0858; phage(gi209447151) 2e-08 Click
2899339..899686 PHAGE_Stx2_converting_1717_NC_011357: transposase; SF0859; phage(gi209447152) 2e-43 Click
3899706..901307 PHAGE_Stx2_converting_1717_NC_011357: transposase; SF0860; phage(gi209447153) 6e-162 Click
4901342..901608 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF0861; phage(gi24111655) 2e-47 Click
5complement(901847..902686) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF0862; phage(gi41057343) 1e-169 Click
6complement(902713..903051) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF0863; phage(gi24373865) 3e-09 Click
7complement(903199..903489) PHAGE_Entero_mEp237_NC_019704: hypothetical protein; SF0864; phage(gi435439317) 5e-24 Click
8903787..904089 PROPHAGE_Xantho_33913: ISxac3 transposase; SF0865; phage(gi21231087) 1e-09 Click
9904125..904943 PROPHAGE_Escher_CFT073: transposase insF; SF0866; phage(gi26249410) 9e-152 Click
10complement(904983..905354) PHAGE_Entero_mEp237_NC_019704: hypothetical protein; SF0867; phage(gi435439315) 1e-28 Click
11complement(905393..905680) conserved hypothetical protein; SF0868 0.0 Click
12complement(906313..906879) conserved hypothetical protein; SF0869 0.0 Click
13907050..907427 hypothetical protein; SF0870 0.0 Click
14complement(907561..907983) putative bacteriophage protein; SF0871 0.0 Click
15complement(908890..909522) PHAGE_Escher_TL_2011b_NC_019445: hypothetical protein; SF0873; phage(gi418487646) 1e-45 Click
16complement(909600..910022) PHAGE_Entero_mEp237_NC_019704: CII protein; SF0874; phage(gi435439306) 4e-08 Click
17complement(910006..910233) PHAGE_Pectob_ZF40_NC_019522: putative cro anti-repressor; SF0875; phage(gi422936651) 2e-09 Click
18910310..910717 PHAGE_Cronob_phiES15_NC_018454: putative transcriptional repressor DicA; SF0876; phage(gi401817574) 4e-32 Click
19910920..911075 PHAGE_Salico_CGphi29_NC_020844: hypothetical protein; SF0877; phage(gi472340166) 8e-09 Click
20complement(911522..912427) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF0878; phage(gi24111655) 8e-179 Click
21complement(912385..912795) PROPHAGE_Escher_CFT073: transposase insC; SF0879; phage(gi26249447) 1e-52 Click
22913190..914146 PHAGE_Entero_mEp460_NC_019716: regulatory protein Rha; SF0880; phage(gi428782357) 2e-55 Click
23914660..914962 PROPHAGE_Xantho_33913: ISxac3 transposase; SF0881; phage(gi21231087) 1e-09 Click
24914998..915816 PROPHAGE_Escher_CFT073: transposase insF; SF0882; phage(gi26249410) 6e-156 Click
25complement(915841..916485) PHAGE_Entero_mEp237_NC_019704: exonuclease; SF0883; phage(gi435439296) 3e-25 Click
26complement(916829..917647) PROPHAGE_Escher_CFT073: transposase insF; SF0884; phage(gi26249410) 2e-154 Click
27complement(917683..917985) PROPHAGE_Xantho_33913: ISxac3 transposase; SF0885; phage(gi21231087) 1e-09 Click
28918051..918668 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF0886; phage(gi18249921) 1e-82 Click

Region 5, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11174910..1174921 attL    GGTGTAGTTAAT 0.0 Click
21174923..1175291 PHAGE_Salmon_vB_SosS_Oslo_NC_018279: integrase; SF1131; phage(gi399528791) 1e-14 Click
31175319..1176173 PHAGE_Salmon_vB_SosS_Oslo_NC_018279: integrase; SF1132; phage(gi399528791) 2e-37 Click
41176794..1177540 conserved hypothetical protein; SF1133 0.0 Click
51178414..1178713 hypothetical bacteriophage protein; SF1134 0.0 Click
61178710..1180458 PHAGE_Entero_EFRM31_NC_015270: DNA primase; SF1135; phage(gi327198106) 2e-13 Click
71180825..1181025 hypothetical bacteriophage protein; SF1136 0.0 Click
81181640..1181864 hypothetical bacteriophage protein; SF1137 0.0 Click
91183362..1183934 PHAGE_Entero_EFRM31_NC_015270: prohead protease; SF1139; phage(gi327198114) 3e-28 Click
101183936..1185147 PHAGE_Shigel_SfIV_NC_022749: portal protein; SF1140; phage(gi557307529) 3e-42 Click
111185144..1185482 PHAGE_Entero_HK97_NC_002167: putative head-tail adaptor; SF1141; phage(gi9634168) 3e-26 Click
121185479..1185775 PHAGE_Shigel_SfII_NC_021857: head-tail connector protein; SF1142; phage(gi526244642) 7e-07 Click
131186003..1186215 PHAGE_Xantho_Xop411_NC_009543: HNH endonuclease; SF1143; phage(gi157325492) 9e-05 Click
141186199..1186381 conserved hypothetical protein; SF1144 0.0 Click
151186452..1186763 PHAGE_Salmon_ST64B_NC_004313: terminase small subunit; SF1145; phage(gi23505446) 1e-11 Click
161186930..1188408 PHAGE_Burkho_KS9_NC_013055: terminase gp2; SF1146; phage(gi255033734) 7e-83 Click
171188422..1188703 hypothetical bacteriophage protein; SF1147 0.0 Click
181189400..1189411 attR    GGTGTAGTTAAT 0.0 Click

Region 6, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11387236..1388432 PROPHAGE_Escher_CFT073: transposase; SF1335; phage(gi26248352) 0.0 Click
2complement(1388578..1388808) conserved hypothetical protein; SF1336 0.0 Click
3complement(1388808..1389728) conserved hypothetical protein; SF1337 0.0 Click
4complement(1390345..1391163) PROPHAGE_Escher_CFT073: transposase insF; SF1339; phage(gi26249410) 9e-157 Click
5complement(1391199..1391501) PROPHAGE_Xantho_33913: ISxac3 transposase; SF1340; phage(gi21231087) 1e-09 Click
6complement(1392029..1392934) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF1342; phage(gi24111655) 4e-179 Click
7complement(1392892..1393302) PROPHAGE_Escher_CFT073: transposase insC; SF1343; phage(gi26249447) 1e-52 Click
81394408..1394842 PHAGE_Gifsy_2_NC_010393: bacteriophage DNA replication protein; SF1344; phage(gi169257280) 2e-47 Click
91394857..1395279 putative bacteriophage protein; SF1345 0.0 Click
101395280..1395693 PHAGE_Stx2_converting_I_NC_003525: hypothetical protein Stx2Ip073; SF1346; phage(gi20065868) 2e-08 Click
111395786..1396004 PHAGE_Stx2_converting_I_NC_003525: hypothetical protein Stx2Ip090; SF1347; phage(gi20065885) 7e-32 Click
121396006..1396371 PHAGE_Entero_HK225_NC_019717: HNH endonuclease; SF1348; phage(gi428782431) 1e-34 Click
131396368..1397033 PHAGE_Vibrio_pYD38_A_NC_021534: hypothetical protein; SF1349; phage(gi514051012) 4e-08 Click
141397033..1397398 PHAGE_Stx2_converting_86_NC_008464: hypothetical protein Stx2-86_gp44; SF1350; phage(gi116222036) 3e-31 Click
15complement(1398514..1398909) PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF1351; phage(gi557307573) 1e-65 Click
16complement(1398936..1399211) PHAGE_Entero_P1_NC_005856: InsA; SF1352; phage(gi46401643) 2e-46 Click
171399345..1399944 PHAGE_Entero_mEp237_NC_019704: hypothetical protein; SF1353; phage(gi435439315) 1e-54 Click
181399944..1400234 PHAGE_Erwini_phiEt88_NC_015295: hypothetical protein; SF1354; phage(gi327198620) 3e-33 Click
191400231..1400785 putative bacteriophage protein; SF1355 0.0 Click
201401173..1401475 PROPHAGE_Xantho_33913: ISxac3 transposase; SF1356; phage(gi21231087) 1e-09 Click
211401511..1402329 PROPHAGE_Escher_CFT073: transposase insF; SF1357; phage(gi26249410) 1e-156 Click
221402357..1402725 PHAGE_Entero_fiAA91_ss_NC_022750: tail fiber; SF1358; phage(gi557307600) 8e-20 Click
231402922..1403293 PHAGE_Entero_phiP27_NC_003356: putative tail fiber assembly protein; SF1359; phage(gi18249919) 2e-54 Click
241403317..1404585 PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF1360; phage(gi18249920) 4e-93 Click
251404596..1405159 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF1361; phage(gi18249921) 8e-83 Click
26complement(1405360..1406217) Iron transport protein, inner membrane component; SF1362 0.0 Click
27complement(1406214..1407071) Iron transport protein; SF1363 0.0 Click
28complement(1407068..1407895) PHAGE_Anomal_entomopoxvirus_NC_023426: putative ATP-binding cassette transporter; SF1364; phage(gi582973124) 9e-19 Click

Region 7, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11409936..1410211 PHAGE_Entero_P1_NC_005856: InsA; SF1366; phage(gi46401643) 4e-47 Click
21410238..1410633 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF1367; phage(gi557307573) 1e-65 Click
3complement(1410822..1410989) conserved hypothetical protein; SF1369 0.0 Click
4complement(1411037..1411705) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfB protein of IS629; SF1370; phage(gi157166067) 2e-123 Click
5complement(1411970..1412296) PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF1371; phage(gi157166066) 4e-57 Click
6complement(1412371..1413414) PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; SF1372; phage(gi401817570) 3e-173 Click
7complement(1413474..1413794) PHAGE_Entero_BP_4795_NC_004813: putative host-nuclease inhibitor protein Gam; SF1373; phage(gi157165999) 7e-43 Click
81414510..1414989 PROPHAGE_Escher_CFT073: transposase insF; SF1374; phage(gi26249410) 2e-87 Click
9complement(1415037..1416461) PHAGE_Gifsy_2_NC_010393: putatitive bacteriophage exodeoxyribonuclease VIII; SF1375; phage(gi169257272) 3e-40 Click
10complement(1416561..1416836) putative bacteriophage protein; SF1376 0.0 Click
11complement(1417081..1417302) PHAGE_Escher_P13374_NC_018846: host killing protein; SF1377; phage(gi410491620) 8e-06 Click
12complement(1417379..1418284) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF1378; phage(gi24114950) 8e-179 Click
13complement(1418242..1418652) PROPHAGE_Escher_CFT073: transposase insC; SF1379; phage(gi26249447) 2e-51 Click
14complement(1418905..1419537) PHAGE_Entero_mEp460_NC_019716: regulatory protein Rha; SF1380; phage(gi428782357) 4e-58 Click
151420761..1421372 PHAGE_Entero_BP_4795_NC_004813: hypothetical protein PBV4795_ORF79; SF1381; phage(gi157166064) 1e-06 Click
161421321..1421884 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF1382; phage(gi18249921) 8e-80 Click
17complement(1422064..1423779) PHAGE_Ostreo_OlV1_NC_014766: hypothetical protein; SF1383; phage(gi313843974) 8e-08 Click
181424372..1424596 PHAGE_Entero_P1_NC_005856: InsA; SF1384; phage(gi46401643) 2e-37 Click
191424623..1425018 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF1385; phage(gi557307573) 3e-68 Click
201426147..1426965 PROPHAGE_Escher_CFT073: transposase insF; SF1387; phage(gi26249410) 9e-157 Click

Region 8, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11915149..1916345 PROPHAGE_Escher_CFT073: transposase; SF1878; phage(gi26248352) 0.0 Click
21917074..1917322 PHAGE_Entero_mEp460_NC_019716: DinI-like protein; SF1879; phage(gi428782337) 5e-41 Click
31917922..1919673 PHAGE_Gifsy_1_NC_010392: leucine-rich repeat protein; SF1880; phage(gi169257209) 2e-10 Click
4complement(1919853..1920476) PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF1881; phage(gi18249921) 2e-78 Click
5complement(1920777..1921838) PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF1882; phage(gi18249920) 2e-65 Click
6complement(1921902..1922501) PHAGE_Entero_mEp460_NC_019716: Lom protein; SF1883; phage(gi428782335) 1e-104 Click
7complement(1922569..1926048) PHAGE_Entero_mEp460_NC_019716: host specificity protein; SF1884; phage(gi428782334) 0.0 Click
8complement(1926109..1926651) PHAGE_Entero_mEp460_NC_019716: tail assembly protein; SF1885; phage(gi428782333) 1e-79 Click
9complement(1926648..1927247) PHAGE_Entero_mEp460_NC_019716: tail fiber component; SF1886; phage(gi428782332) 7e-120 Click
10complement(1927396..1928094) PHAGE_Entero_mEp460_NC_019716: minor tail protein; SF1887; phage(gi428782331) 2e-120 Click
11complement(1928094..1928423) PHAGE_Entero_mEp460_NC_019716: minor tail protein; SF1888; phage(gi428782330) 3e-58 Click
12complement(1928423..1931464) PHAGE_Entero_mEp460_NC_019716: tail length tape measure protein; SF1889; phage(gi428782329) 0.0 Click
13complement(1931436..1931711) PHAGE_Entero_mEp460_NC_019716: tail assembly protein; SF1890; phage(gi428782328) 1e-47 Click
14complement(1931774..1932160) PHAGE_Entero_mEp460_NC_019716: minor tail protein; SF1891; phage(gi428782327) 6e-63 Click
15complement(1932219..1932959) PHAGE_Entero_mEp460_NC_019716: major tail protein; SF1892; phage(gi428782326) 4e-133 Click
16complement(1932970..1933371) PHAGE_Entero_mEp460_NC_019716: minor tail protein; SF1893; phage(gi428782325) 1e-72 Click
17complement(1933368..1933958) PHAGE_Entero_mEp460_NC_019716: minor tail protein; SF1894; phage(gi428782324) 1e-80 Click
18complement(1933945..1934316) PHAGE_Entero_HK630_NC_019723: head-tail connector Fii; SF1895; phage(gi428782797) 4e-28 Click
19complement(1934328..1934729) PHAGE_Entero_HK225_NC_019717: head assembly protein Fi; SF1896; phage(gi428782384) 2e-15 Click
201934993..1936189 PROPHAGE_Escher_CFT073: transposase; SF1897; phage(gi26248352) 0.0 Click
21complement(1936889..1936963) tRNA 0.0 Click
22complement(1936967..1937042) tRNA 0.0 Click
23complement(1937045..1937121) tRNA 0.0 Click
24complement(1937123..1937198) tRNA 0.0 Click
25complement(1937375..1938064) PHAGE_Gifsy_1_NC_010392: bacteriophage antiterminator protein Q; SF1898; phage(gi169257244) 4e-78 Click
26complement(1938061..1938420) PHAGE_Entero_c_1_NC_019706: holliday-junction resolvase RusA; SF1899; phage(gi428781794) 3e-40 Click
271938624..1938926 PROPHAGE_Xantho_33913: ISxac3 transposase; SF1900; phage(gi21231087) 2e-09 Click
281938962..1939780 PROPHAGE_Escher_CFT073: transposase insF; SF1901; phage(gi26249410) 2e-158 Click
29complement(1940293..1940670) PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF1902; phage(gi557307573) 2e-69 Click
30complement(1940715..1940942) PHAGE_Entero_P1_NC_005856: InsA; SF1903; phage(gi46401643) 1e-39 Click
311941076..1941903 PHAGE_Entero_phiP27_NC_003356: putative serine protease; SF1904; phage(gi18249869) 2e-149 Click
321941947..1942696 PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p14; SF1905; phage(gi18249878) 2e-54 Click
331942693..1943262 PHAGE_Salmon_Fels_1_NC_010391: hypothetical protein STM0896.2n.Fels1; SF1906; phage(gi169257162) 8e-25 Click
34complement(1943959..1944798) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF1907; phage(gi41057343) 1e-169 Click
35complement(1944825..1945163) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF1908; phage(gi24373865) 3e-09 Click
361945760..1946155 conserved hypothetical protein; SF1910 0.0 Click
371946196..1946939 PHAGE_Synech_S_CRM01_NC_015569: methyltransferase domain-containing protein; SF1911; phage(gi333798309) 2e-24 Click

Region 9, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2030314..2030784) PHAGE_Burkho_KL3_NC_015266: gp46; SF2004; phage(gi327198091) 1e-34 Click
2complement(2030765..2032183) PHAGE_Burkho_KL3_NC_015266: gp47; SF2005; phage(gi327198092) 8e-102 Click
3complement(2033088..2033900) PHAGE_Shigel_SfIV_NC_022749: ISEhe3 orfB; SF2007; phage(gi557307549) 5e-149 Click
4complement(2033957..2034241) PHAGE_Shigel_SfIV_NC_022749: ISEhe3 orfA; SF2008; phage(gi557307550) 6e-36 Click
52034262..2035110 putative outer membrane pore protein; SF2009 0.0 Click
6complement(2035081..2035986) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF2010; phage(gi24111655) 4e-179 Click
7complement(2035944..2036354) PROPHAGE_Escher_CFT073: transposase insC; SF2011; phage(gi26249447) 1e-52 Click
82037210..2037485 PHAGE_Entero_P1_NC_005856: InsA; SF2012; phage(gi46401643) 4e-47 Click
92037512..2037907 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF2013; phage(gi557307573) 3e-68 Click
102037953..2038804 conserved hypothetical protein; SF2014 0.0 Click
11complement(2038912..2040270) PHAGE_Feldma_species_virus_NC_011183: putative hybrid sensor histdine kinase; SF2015; phage(gi197322490) 6e-06 Click
12complement(2040270..2040941) PHAGE_Ectoca_siliculosus_virus_1_NC_002687: EsV-1-65; SF2016; phage(gi13242537) 2e-06 Click
132041074..2041487 conserved hypothetical protein; SF2017 0.0 Click
142042601..2043236 conserved hypothetical protein; SF2019 0.0 Click
152043494..2044144 conserved hypothetical protein; SF2020 0.0 Click
162045529..2045540 attL    TCACAAATAAAA 0.0 Click
172045548..2046216 conserved hypothetical protein; SF2021 0.0 Click
182047252..2048460 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SF2023; phage(gi24375070) 3e-124 Click
19complement(2049693..2050070) PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF2024; phage(gi18249921) 5e-51 Click
20complement(2050213..2051247) PROPHAGE_Escher_CFT073: transposase insF; SF2025; phage(gi26249410) 1e-155 Click
212051322..2051825 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF2026; phage(gi557307573) 7e-87 Click
22complement(2051918..2052400) hypothetical protein; SF2027 0.0 Click
23complement(2052468..2054417) PHAGE_Shigel_SfIV_NC_022749: tail tape measure protein; SF2028; phage(gi557307539) 0.0 Click
24complement(2054502..2054837) PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; SF2029; phage(gi557307538) 1e-38 Click
25complement(2054837..2055193) PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; SF2030; phage(gi557307537) 4e-54 Click
26complement(2055193..2056689) PHAGE_Shigel_SfIV_NC_022749: tail sheath protein; SF2031; phage(gi557307536) 0.0 Click
27complement(2056857..2057111) PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; SF2032; phage(gi557307535) 1e-25 Click
28complement(2057241..2058059) PROPHAGE_Escher_CFT073: transposase insF; SF2033; phage(gi26249410) 8e-156 Click
29complement(2058095..2058397) PROPHAGE_Xantho_33913: ISxac3 transposase; SF2034; phage(gi21231087) 1e-09 Click
30complement(2058449..2059276) PHAGE_Stx2_converting_1717_NC_011357: transposase; SF2035; phage(gi209447153) 2e-58 Click
31complement(2059296..2059643) PHAGE_Stx2_converting_1717_NC_011357: transposase; SF2036; phage(gi209447152) 2e-42 Click
32complement(2059640..2060314) PHAGE_Stx2_converting_1717_NC_011357: truncated transposase; SF2037; phage(gi209447151) 2e-08 Click
33complement(2060413..2060628) PHAGE_Escher_P13374_NC_018846: lysis protein, holin; SF2038; phage(gi410491645) 9e-27 Click
34complement(2060921..2060995) tRNA 0.0 Click
35complement(2060999..2061074) tRNA 0.0 Click
36complement(2061077..2061153) tRNA 0.0 Click
37complement(2061155..2061230) tRNA 0.0 Click
38complement(2061429..2062112) PHAGE_Gifsy_1_NC_010392: bacteriophage antiterminator protein Q; SF2039; phage(gi169257244) 2e-81 Click
39complement(2062109..2062474) PHAGE_Entero_c_1_NC_019706: holliday-junction resolvase RusA; SF2040; phage(gi428781794) 2e-39 Click
40complement(2062475..2063461) PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; SF2041; phage(gi557307571) 1e-83 Click
41complement(2063535..2063813) PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; SF2042; phage(gi401817580) 9e-11 Click
42complement(2064788..2065123) hypothetical bacteriophage protein; SF2043 0.0 Click
432065551..2066396 PHAGE_Salmon_ST64B_NC_004313: Integrase protein; SF2044; phage(gi23505472) 2e-97 Click
44complement(2066449..2066538) tRNA 0.0 Click
452066593..2067429 conserved hypothetical protein; SF2045 0.0 Click
462067524..2067556 attL    CACGATTCCTCTGTAGTTCAGTCGGTAGAACGG 0.0 Click
472067530..2067605 tRNA 0.0 Click
482068280..2068651 PROPHAGE_Escher_CFT073: prophage P4 integrase; SF2046; phage(gi26248270) 2e-31 Click
492068720..2069028 PROPHAGE_Escher_CFT073: prophage P4 integrase; SF2047; phage(gi26248270) 1e-57 Click
50complement(2069136..2069975) PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; SF2048; phage(gi41057343) 1e-169 Click
51complement(2070002..2070340) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SF2049; phage(gi24373865) 3e-09 Click
522070931..2071233 PROPHAGE_Xantho_33913: ISxac3 transposase; SF2051; phage(gi21231087) 2e-09 Click
532071269..2072060 PROPHAGE_Escher_CFT073: transposase insF; SF2052; phage(gi26249410) 3e-148 Click
542079593..2079625 attR    CACGATTCCTCTGTAGTTCAGTCGGTAGAACGG 0.0 Click
552085766..2085777 attR    TCACAAATAAAA 0.0 Click

Region 10, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12229978..2231186 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SF2203; phage(gi24375070) 3e-124 Click
2complement(2232419..2232796) PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF2204; phage(gi18249921) 5e-51 Click
3complement(2232973..2234262) PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF2205; phage(gi18249920) 2e-92 Click
4complement(2234286..2234774) PHAGE_Entero_phiP27_NC_003356: putative tail fiber assembly protein; SF2206; phage(gi18249919) 4e-65 Click
5complement(2234834..2235247) PHAGE_Entero_fiAA91_ss_NC_022750: tail fiber; SF2207; phage(gi557307600) 7e-24 Click
62235289..2235564 PHAGE_Entero_P1_NC_005856: InsA; SF2208; phage(gi46401643) 4e-47 Click
72235591..2235986 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF2209; phage(gi557307573) 1e-67 Click
82236685..2237011 PHAGE_Entero_BP_4795_NC_004813: putative transposase OrfA protein of IS629; SF2211; phage(gi157166066) 1e-55 Click
92237226..2237894 PROPHAGE_Escher_CFT073: transposase IS629; SF2212; phage(gi26250986) 7e-124 Click
10complement(2238540..2239271) putative transport system permease protein; SF2213 0.0 Click
11complement(2239276..2240202) PHAGE_Bacill_G_NC_023719: gp245; SF2214; phage(gi593777701) 1e-24 Click
12complement(2240195..2241352) PHAGE_Bacill_G_NC_023719: gp243; SF2215; phage(gi593777699) 7e-07 Click

Region 11, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2684931..2685371) PHAGE_Entero_Fels_2_NC_010463: DNA-invertase; SF2609; phage(gi169936026) 1e-73 Click
22685872..2687698 PHAGE_Acanth_mimivirus_NC_014649: putative leucine-rich repeat protein; SF2610; phage(gi311977765) 5e-09 Click
3complement(2687878..2688501) PHAGE_Entero_phiP27_NC_003356: hypothetical protein P27p57; SF2611; phage(gi18249921) 2e-78 Click
4complement(2688802..2689668) PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF2612; phage(gi18249920) 6e-77 Click
5complement(2689740..2690228) PHAGE_Entero_phiP27_NC_003356: putative tail fiber assembly protein; SF2613; phage(gi18249919) 4e-65 Click
6complement(2690288..2690806) PHAGE_Entero_fiAA91_ss_NC_022750: tail fiber; SF2614; phage(gi557307600) 2e-24 Click
72690825..2691235 PROPHAGE_Escher_CFT073: transposase insC; SF2615; phage(gi26249447) 1e-52 Click
82691193..2692098 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF2616; phage(gi24114950) 8e-179 Click
9complement(2691932..2693011) PHAGE_Entero_phiP27_NC_003356: putative tail fiber protein; SF2617; phage(gi18249918) 1e-67 Click
10complement(2692998..2693603) PHAGE_Aeromo_vB_AsaM_56_NC_019527: hypothetical protein; SF2618; phage(gi422937564) 1e-32 Click
11complement(2693605..2694072) PHAGE_Acinet_AP22_NC_017984: putative baseplate J-like protein; SF2619; phage(gi388570818) 4e-10 Click
122694367..2694669 PROPHAGE_Xantho_33913: ISxac3 transposase; SF2620; phage(gi21231087) 1e-09 Click
132694810..2695523 PROPHAGE_Escher_CFT073: transposase insF; SF2621; phage(gi26249410) 5e-134 Click

Region 12, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14115337..4116320 PHAGE_Strept_Sfi11_NC_002214: putative minor tail protein; SF3986; phage(gi9635024) 4e-06 Click
2complement(4116350..4117255) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SF3987; phage(gi24114950) 8e-179 Click
3complement(4117213..4117623) PROPHAGE_Escher_CFT073: transposase insC; SF3988; phage(gi26249447) 8e-52 Click
44117805..4118479 conserved hypothetical protein; SF3989 0.0 Click
5complement(4118585..4119958) PHAGE_Feldma_species_virus_NC_011183: putative hybrid sensor histdine kinase; SF3990; phage(gi197322490) 1e-08 Click
6complement(4119955..4120653) PHAGE_Feldma_species_virus_NC_011183: putative sensor histidine kinase; SF3991; phage(gi197322366) 5e-09 Click
74120935..4121303 conserved hypothetical protein; SF3992 0.0 Click
84121451..4122353 putative transport system permease protein; SF3993 0.0 Click
94122552..4123496 PHAGE_Ostreo_OlV5_NC_020852: 6-phosphofructokinase; SF3994; phage(gi472341206) 1e-14 Click

Region 13, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14505106..4505414 host factor I for bacteriophage Q beta replication; SF4327 0.0 Click
24505490..4506770 GTP-binding subunit of protease specific for phage lambda cII repressor; SF4328 0.0 Click
34506856..4508115 PROPHAGE_Escher_Sakai: FtsH protease regulator HflK; SF4329; phage(gi15834404) 0.0 Click
44508118..4509122 PROPHAGE_Escher_Sakai: FtsH protease regulator HflC; SF4330; phage(gi15834405) 0.0 Click
54509204..4509401 conserved hypothetical protein; SF4331 0.0 Click
64509505..4510803 PHAGE_Pandor_dulcis_NC_021858: adenylosuccinate synthetase; SF4332; phage(gi526120041) 2e-67 Click
74511008..4511433 conserved hypothetical protein; SF4333 0.0 Click
84511430..4513913 PHAGE_Lactoc_Q54_NC_008364: putative ribonuclease; SF4334; phage(gi115304286) 1e-70 Click
94514093..4514824 conserved hypothetical protein; SF4335 0.0 Click
104514925..4515200 PHAGE_Entero_P1_NC_005856: InsA; SF4336; phage(gi46401643) 2e-46 Click
114515227..4515622 PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF4337; phage(gi557307573) 4e-67 Click
124515888..4516526 PHAGE_Entero_4MG_NC_022968: hyphothetical protein; SF4338; phage(gi563397481) 1e-08 Click
134516529..4517692 PHAGE_Ralsto_RSL1_NC_010811: gsp gene product; SF4339; phage(gi189426829) 1e-79 Click
144517758..4519140 putative carnitine operon oxidoreductase; SF4340 0.0 Click
15complement(4519075..4519470) PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; SF4341; phage(gi557307573) 1e-67 Click
16complement(4519497..4519772) PHAGE_Entero_P1_NC_005856: InsA; SF4342; phage(gi46401643) 4e-47 Click