Escherichia coli O157:H7 str. TW14588 gcontig_1117790713604, whole [asmbl_id: NC_000000].1308668, GC%: 50.68%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1663893..663904 attL    GTTTTTTCTGGC 0.0 Click
2664122..665327 PHAGE_Temper_1: integrase-like protein; ESCCO14588_5200; phage(gi16271777) 8e-07 Click
3665329..666441 site-specific recombinase, phage integrase family protein; ESCCO14588_5199 0.0 Click
4666509..666643 conserved hypothetical protein; ESCCO14588_5198 0.0 Click
5666640..668271 conserved DNA-binding protein; ESCCO14588_5197 0.0 Click
6668449..668670 conserved hypothetical protein; ESCCO14588_5196 0.0 Click
7668768..669181 conserved hypothetical protein; ESCCO14588_5195 0.0 Click
8669721..670797 PHAGE_Cafete_BV_PW1: hypothetical protein; ESCCO14588_5194; phage(gi310831380) 7e-18 Click
9complement(670873..671151) conserved hypothetical protein; ESCCO14588_5193 0.0 Click
10complement(671211..671966) PROPHAGE_Escher_MG1655: IS30 transposase; ESCCO14588_5192; phage(gi16132105) 2e-141 Click
11672867..673478 PHAGE_Stx2_c_1717: NinG protein; ESCCO14588_5191; phage(gi209447163) 5e-101 Click
12673475..674140 PHAGE_Stx2_c_1717: NinI protein; ESCCO14588_5190; phage(gi209447164) 3e-130 Click
13674137..674760 PHAGE_Entero_mEpX1: late gene regulator Q; ESCCO14588_5189; phage(gi428781929) 7e-116 Click
14674831..674947 hypothetical protein; ESCCO14588_5188 0.0 Click
15675040..675756 conserved hypothetical protein; ESCCO14588_5187 0.0 Click
16675842..676009 PHAGE_Entero_P1: TciB; ESCCO14588_5186; phage(gi46401695) 1e-06 Click
17676417..678270 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ESCCO14588_5185; phage(gi209447169) 0.0 Click
18678420..678635 PHAGE_Stx2_c_1717: holin protein S-like protein; ESCCO14588_5184; phage(gi209447171) 7e-35 Click
19678640..678984 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ESCCO14588_5183; phage(gi157166032) 3e-60 Click
20679035..679265 PHAGE_Entero_2008: putative endolysin; ESCCO14588_5182; phage(gi209427769) 4e-35 Click
21679718..680065 PHAGE_Stx2_c_1717: transposase; ESCCO14588_5181; phage(gi209447152) 2e-62 Click
22complement(680566..681456) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_5180; phage(gi15834498) 2e-173 Click
23complement(681453..681779) PHAGE_Stx2_c_1717: putative transposase; ESCCO14588_5179; phage(gi209447180) 1e-58 Click
24681846..682094 PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_5178; phage(gi302393091) 1e-38 Click
25682270..682677 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ESCCO14588_5177; phage(gi209447201) 4e-21 Click
26684709..684720 attR    GTTTTTTCTGGC 0.0 Click

Region 2, total : 91 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1949625..949636 attL    TTTTTTGCTCGC 0.0 Click
2complement(960926..961552) PHAGE_Staphy_StB27: integrase; ESCCO14588_4896; phage(gi431809677) 3e-10 Click
3962218..963630 conserved hypothetical protein; ESCCO14588_4895 0.0 Click
4complement(964301..964996) hypothetical protein; ESCCO14588_4894 0.0 Click
5965018..965548 PHAGE_Entero_Sf6: gene 9 protein; ESCCO14588_4893; phage(gi41057287) 9e-92 Click
6965548..966015 PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ESCCO14588_4892; phage(gi89885999) 2e-64 Click
7966002..966682 PHAGE_Sodali_phiSG1: phage DNA transfer protein; ESCCO14588_4891; phage(gi89886000) 2e-75 Click
8966692..967252 PHAGE_Salmon_vB_SemP_Emek: injection protein; ESCCO14588_4890; phage(gi399498803) 3e-31 Click
9967677..967826 putative DNA injection protein; ESCCO14588_4889 0.0 Click
10complement(968000..969157) PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ESCCO14588_4888; phage(gi15832485) 0.0 Click
11969156..969314 PHAGE_Entero_HK633: hypothetical protein; ESCCO14588_4887; phage(gi428782546) 3e-16 Click
12complement(969319..969393) tRNA 0.0 Click
13969370..969393 attL    TTATATCCATTTAACTAAGAGGAC 0.0 Click
14969589..970758 PHAGE_Stx2_c_86: integrase; ESCCO14588_4884; phage(gi116222028) 0.0 Click
15complement(970742..970924) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; ESCCO14588_4885; phage(gi116222029) 3e-28 Click
16complement(970985..971236) PHAGE_Escher_TL_2011c: putative bacteriophage protein; ESCCO14588_4883; phage(gi418487053) 4e-41 Click
17971498..971620 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4881; phage(gi410491599) 4e-17 Click
18complement(971601..972017) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4882; phage(gi418487077) 2e-58 Click
19complement(972053..972265) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4880; phage(gi418487078) 9e-32 Click
20complement(972225..972851) PHAGE_Escher_TL_2011c: adenine methylase; ESCCO14588_4879; phage(gi418487054) 2e-122 Click
21complement(972848..973279) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4878; phage(gi418487079) 3e-78 Click
22complement(973335..974012) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4877; phage(gi418487090) 6e-97 Click
23974337..974594 addiction module antidote protein; ESCCO14588_4876 0.0 Click
24975010..975315 PHAGE_Azospi_Cd: Helix-turn-helix motif; ESCCO14588_4875; phage(gi168495160) 4e-08 Click
25complement(975358..975960) PHAGE_Lactob_phiadh: hypothetical protein phiadhp07; ESCCO14588_4874; phage(gi9633007) 9e-14 Click
26complement(975920..976096) PHAGE_Entero_P1: Ant2; ESCCO14588_4873; phage(gi46401670) 3e-11 Click
27complement(976190..976813) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip087; ESCCO14588_4872; phage(gi20065882) 2e-120 Click
28complement(976817..977104) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip089; ESCCO14588_4871; phage(gi20065884) 1e-51 Click
29complement(977106..977324) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ESCCO14588_4870; phage(gi20065885) 1e-36 Click
30complement(977326..977541) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip092; ESCCO14588_4869; phage(gi20065887) 4e-39 Click
31complement(977553..977672) hypothetical protein; ESCCO14588_4868 0.0 Click
32complement(977883..978656) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip094; ESCCO14588_4867; phage(gi20065889) 2e-146 Click
33complement(978973..979188) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ESCCO14588_4866; phage(gi20065893) 5e-35 Click
34complement(979265..979378) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ESCCO14588_4865; phage(gi20065894) 4e-14 Click
35complement(979608..980288) PHAGE_Escher_TL_2011c: putative exonuclease; ESCCO14588_4864; phage(gi418487057) 8e-132 Click
36complement(980285..981235) PHAGE_Escher_TL_2011c: RecT; ESCCO14588_4863; phage(gi418487123) 6e-179 Click
37complement(981252..981533) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4862; phage(gi418487088) 2e-50 Click
38complement(981554..981835) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4861; phage(gi418487089) 5e-37 Click
39complement(981847..982059) PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4860; phage(gi418487058) 1e-34 Click
40complement(982130..982903) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; ESCCO14588_4859; phage(gi418487059) 2e-115 Click
41complement(983533..984486) PHAGE_Escher_TL_2011c: type II restriction enzyme BsuBI; ESCCO14588_4858; phage(gi418487060) 0.0 Click
42complement(984483..985952) PHAGE_Escher_TL_2011c: modification methylase BsuBI; ESCCO14588_4857; phage(gi418487061) 0.0 Click
43complement(986047..986760) PHAGE_Escher_TL_2011c: repressor protein CI; ESCCO14588_4856; phage(gi418487062) 2e-134 Click
44986856..987059 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4855; phage(gi418487091) 1e-31 Click
45987230..987424 hypothetical protein; ESCCO14588_4854 0.0 Click
46987837..987968 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4853; phage(gi418487092) 2e-18 Click
47987962..989482 PHAGE_Escher_TL_2011c: helicase domain protein; ESCCO14588_4852; phage(gi418487063) 0.0 Click
48989472..990443 PHAGE_Escher_TL_2011c: putative phage DNA primase; ESCCO14588_4851; phage(gi418487064) 0.0 Click
49990443..990892 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4850; phage(gi418487093) 4e-81 Click
50990900..991463 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4849; phage(gi418487094) 2e-104 Click
51991460..991654 PHAGE_Stx2_c_II: NinH protein; ESCCO14588_4848; phage(gi302393155) 2e-32 Click
52991647..992081 PHAGE_Stx2_c_86: antitermination protein Q; ESCCO14588_4847; phage(gi116222072) 2e-83 Click
53992330..992482 PHAGE_Stx2_c_86: DNA modification methylase; ESCCO14588_4846; phage(gi116222073) 1e-19 Click
54992523..992598 tRNA 0.0 Click
55992607..992685 tRNA 0.0 Click
56992697..992775 tRNA 0.0 Click
57993042..993824 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit A; ESCCO14588_4842; phage(gi418487067) 7e-146 Click
58993836..994105 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit B; ESCCO14588_4841; phage(gi418487068) 1e-46 Click
59994592..996091 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; ESCCO14588_4840; phage(gi20065943) 0.0 Click
60996126..996530 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4839; phage(gi418487095) 3e-73 Click
61996667..996846 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4838; phage(gi410491643) 2e-28 Click
62996887..997132 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4837; phage(gi418487098) 2e-24 Click
63997210..997962 PHAGE_Stx2_c_II: endolysin; ESCCO14588_4836; phage(gi302393165) 2e-103 Click
64998233..998802 PHAGE_Stx2_c_II: putative antirepressor protein Ant; ESCCO14588_4835; phage(gi302393166) 7e-107 Click
65998802..998948 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_4834; phage(gi302861202) 2e-20 Click
66998956..999423 PHAGE_Entero_Sakai: Rz; ESCCO14588_4833; phage(gi9633443) 4e-82 Click
67complement(999652..1000542) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4832; phage(gi15834498) 2e-173 Click
68complement(1000539..1000865) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4831; phage(gi15832212) 3e-58 Click
691000964..1001464 PHAGE_Escher_P13374: regulatory protein; ESCCO14588_4830; phage(gi410491650) 3e-92 Click
701001588..1001701 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ESCCO14588_4829; phage(gi20065959) 6e-17 Click
711001757..1002551 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip165; ESCCO14588_4828; phage(gi20065960) 7e-147 Click
721002577..1004238 PHAGE_Escher_P13374: phage terminase large subunit; ESCCO14588_4827; phage(gi410491652) 0.0 Click
731004238..1006382 PHAGE_Escher_TL_2011c: putative portal protein; ESCCO14588_4826; phage(gi418487074) 0.0 Click
741006540..1007547 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4825; phage(gi410491654) 0.0 Click
751007571..1008785 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4824; phage(gi418487102) 0.0 Click
761008841..1009230 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4823; phage(gi418487103) 2e-66 Click
771009280..1009741 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4822; phage(gi418487104) 2e-82 Click
781009725..1010288 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4821; phage(gi418487105) 2e-104 Click
791010288..1010938 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip017; ESCCO14588_4820; phage(gi20065813) 8e-123 Click
801010935..1011384 PHAGE_Stx2_c_II: putative tail fiber protein; ESCCO14588_4818; phage(gi302393090) 8e-68 Click
81complement(1011344..1011745) hypothetical protein; ESCCO14588_4819 0.0 Click
821011734..1012873 PHAGE_Escher_TL_2011c: putative tail fiber protein; ESCCO14588_4817; phage(gi418487108) 0.0 Click
831012875..1013144 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4816; phage(gi418487109) 4e-47 Click
841013284..1013472 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4815; phage(gi418487110) 4e-31 Click
851013539..1013652 hypothetical protein; ESCCO14588_4814 0.0 Click
861013767..1015392 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip030; ESCCO14588_4813; phage(gi20065826) 0.0 Click
871015389..1016657 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4812; phage(gi418487112) 0.0 Click
881016672..1016950 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ESCCO14588_4811; phage(gi302393094) 8e-52 Click
891016956..1017573 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4810; phage(gi418487113) 4e-122 Click
901017664..1018398 PHAGE_Escher_TL_2011c: outer membrane protein Lom precursor; ESCCO14588_4809; phage(gi418487075) 4e-140 Click
911018631..1018771 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4808; phage(gi418487114) 5e-11 Click
921018852..1019229 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4807; phage(gi410491668) 1e-69 Click
931019323..1019979 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip042; ESCCO14588_4806; phage(gi20065838) 5e-122 Click
941019982..1020428 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip045; ESCCO14588_4805; phage(gi20065841) 2e-80 Click
951020438..1020689 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4804; phage(gi418487118) 2e-40 Click
961020700..1021965 PHAGE_Escher_TL_2011c: hypothetical protein; ESCCO14588_4803; phage(gi418487119) 0.0 Click
971022035..1030419 PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ESCCO14588_4802; phage(gi302861144) 0.0 Click
981030542..1030565 attR    TTATATCCATTTAACTAAGAGGAC 0.0 Click
991031618..1031629 attR    TTTTTTGCTCGC 0.0 Click

Region 3, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11271345..1271357 attL    AGATTAAAGAAGA 0.0 Click
21277191..1278117 PHAGE_Plankt_PaV_LD: ABC transporter; ESCCO14588_4560; phage(gi371496158) 4e-25 Click
31278122..1278853 ABC transporter, quaternary amine uptake (QAT) family, permease protein; ESCCO14588_4559 0.0 Click
4complement(1279001..1279648) conserved hypothetical protein; ESCCO14588_4558 0.0 Click
5complement(1279723..1281009) PROPHAGE_Escher_Sakai: putative integrase; ESCCO14588_4557; phage(gi15832267) 0.0 Click
6complement(1281043..1281183) PHAGE_Entero_2008: putative excisionase; ESCCO14588_4556; phage(gi209427728) 8e-23 Click
7complement(1281454..1281597) PHAGE_Entero_2008: hypothetical protein YYZ_gp04; ESCCO14588_4555; phage(gi209427730) 7e-21 Click
8complement(1281784..1282146) PHAGE_Entero_2008: hypothetical protein YYZ_gp05; ESCCO14588_4554; phage(gi209427731) 7e-74 Click
9complement(1282833..1283009) PHAGE_Entero_2008: hypothetical protein YYZ_gp08; ESCCO14588_4552; phage(gi209427734) 9e-29 Click
10complement(1283011..1283958) PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ESCCO14588_4551; phage(gi209427735) 0.0 Click
11complement(1284275..1284490) PHAGE_Stx1_converting: hypothetical protein Stx1_gp42; ESCCO14588_4550; phage(gi302861164) 5e-35 Click
12complement(1284567..1284680) PHAGE_Stx1_converting: hypothetical protein Stx1_gp43; ESCCO14588_4549; phage(gi302861165) 4e-14 Click
13complement(1284913..1285590) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; ESCCO14588_4548; phage(gi20065897) 4e-132 Click
14complement(1285587..1286372) PHAGE_Stx2_c_I: Bet protein; ESCCO14588_4547; phage(gi20065900) 2e-151 Click
15complement(1286378..1286674) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ESCCO14588_4546; phage(gi116222045) 4e-51 Click
16complement(1286750..1286893) PHAGE_Stx2_c_86: putative host killing protein Kil; ESCCO14588_4545; phage(gi116222047) 8e-20 Click
17complement(1287099..1287467) PHAGE_Stx2_c_I: Ea10 protein; ESCCO14588_4544; phage(gi20065907) 5e-68 Click
181287728..1288309 PHAGE_Entero_HK140: superinfection exclusion protein; ESCCO14588_4543; phage(gi428781984) 4e-109 Click
19complement(1288326..1288598) PHAGE_Entero_HK629: transcription antitermination protein N; ESCCO14588_4542; phage(gi428782056) 7e-45 Click
20complement(1289111..1289542) PHAGE_Entero_HK544: hypothetical protein; ESCCO14588_4541; phage(gi428783255) 4e-74 Click
21complement(1289669..1289950) PHAGE_Entero_HK544: hypothetical protein; ESCCO14588_4540; phage(gi428783256) 1e-47 Click
22complement(1290073..1290645) PHAGE_Entero_mEpX1: prophage repressor; ESCCO14588_4539; phage(gi428781915) 1e-108 Click
23complement(1291258..1292148) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4538; phage(gi15834498) 2e-173 Click
24complement(1292145..1292471) PROPHAGE_Escher_Sakai: putative transposase; ESCCO14588_4537; phage(gi15832212) 3e-58 Click
25complement(1292591..1292713) hypothetical protein; ESCCO14588_4536 0.0 Click
261292804..1293742 PHAGE_Entero_4795: putative replication protein O; ESCCO14588_4535; phage(gi157166011) 0.0 Click
271293739..1294440 PHAGE_Entero_4795: putative replication protein P; ESCCO14588_4534; phage(gi157166012) 1e-131 Click
281294437..1294727 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ESCCO14588_4533; phage(gi20065923) 2e-49 Click
291294798..1295076 PHAGE_Stx1_converting: hypothetical protein Stx1_gp62; ESCCO14588_4532; phage(gi302861184) 5e-51 Click
301295309..1295671 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ESCCO14588_4531; phage(gi20065926) 2e-67 Click
311295628..1296074 PHAGE_Stx1_converting: NinB protein; ESCCO14588_4530; phage(gi302861187) 2e-83 Click
321296071..1296598 PHAGE_Stx1_converting: DNA N-6-adenine-methyltransferase; ESCCO14588_4529; phage(gi302861188) 1e-101 Click
331296774..1297175 PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ESCCO14588_4528; phage(gi302861190) 3e-76 Click
341297337..1297942 PHAGE_Stx1_converting: NinG protein; ESCCO14588_4527; phage(gi302861192) 1e-118 Click
351297939..1298133 PHAGE_Stx1_converting: NinH protein; ESCCO14588_4526; phage(gi302861193) 2e-32 Click
361298126..1298560 PHAGE_Stx1_converting: antitermination protein Q; ESCCO14588_4525; phage(gi302861194) 2e-83 Click
371299067..1300014 PHAGE_Stx1_converting: Shiga toxin 1 subunit A; ESCCO14588_4524; phage(gi302861195) 1e-176 Click
381300107..1300292 PHAGE_Stx1_converting: Shiga toxin 1 subunit B; ESCCO14588_4523; phage(gi302861196) 4e-30 Click
391300803..1302749 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ESCCO14588_4522; phage(gi302861197) 0.0 Click
401302887..1303066 PHAGE_Escher_P13374: hypothetical protein; ESCCO14588_4521; phage(gi410491643) 2e-28 Click
411303107..1303352 PHAGE_Stx1_converting: hypothetical protein Stx1_gp76; ESCCO14588_4520; phage(gi302861198) 6e-39 Click
421303430..1303645 PHAGE_Stx1_converting: holin; ESCCO14588_4519; phage(gi302861199) 2e-35 Click
431303605..1303617 attR    AGATTAAAGAAGA 0.0 Click
441303650..1304183 PHAGE_Stx1_converting: endolysin; ESCCO14588_4518; phage(gi302861200) 1e-103 Click
451304454..1305023 PHAGE_Stx1_converting: putative antirepressor protein Ant; ESCCO14588_4517; phage(gi302861201) 7e-107 Click
461305023..1305169 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ESCCO14588_4516; phage(gi302861202) 2e-20 Click
471305177..1305644 PHAGE_Stx1_converting: endopeptidase Rz; ESCCO14588_4515; phage(gi302861203) 2e-79 Click
48complement(1305794..1306066) conserved hypothetical protein; ESCCO14588_4514 0.0 Click
491306099..1306575 PHAGE_Salmon_1: bacteriophage terminase, small subunit; ESCCO14588_4513; phage(gi169257184) 3e-47 Click
501306572..1308668 PROPHAGE_Escher_Sakai: putative terminase large subunit; ESCCO14588_4512; phage(gi15832217) 0.0 Click